ID: 1180100383

View in Genome Browser
Species Human (GRCh38)
Location 21:45581241-45581263
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180100375_1180100383 19 Left 1180100375 21:45581199-45581221 CCAGACGGATTTCAGAATTGCTA No data
Right 1180100383 21:45581241-45581263 ACCCGTGCCCCTCTTGGGAGTGG No data
1180100374_1180100383 20 Left 1180100374 21:45581198-45581220 CCCAGACGGATTTCAGAATTGCT No data
Right 1180100383 21:45581241-45581263 ACCCGTGCCCCTCTTGGGAGTGG No data
1180100373_1180100383 26 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100383 21:45581241-45581263 ACCCGTGCCCCTCTTGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180100383 Original CRISPR ACCCGTGCCCCTCTTGGGAG TGG Intergenic
No off target data available for this crispr