ID: 1180100406

View in Genome Browser
Species Human (GRCh38)
Location 21:45581342-45581364
Sequence CATGATCTCCTCATCCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180100406_1180100418 25 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100418 21:45581390-45581412 GCGGCACCGGGGCTTAGAGCAGG No data
1180100406_1180100413 0 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100413 21:45581365-45581387 AACTGGGAGCGATATTCTGGGGG No data
1180100406_1180100416 13 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100416 21:45581378-45581400 ATTCTGGGGGATGCGGCACCGGG No data
1180100406_1180100412 -1 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100412 21:45581364-45581386 GAACTGGGAGCGATATTCTGGGG No data
1180100406_1180100411 -2 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100411 21:45581363-45581385 TGAACTGGGAGCGATATTCTGGG No data
1180100406_1180100417 14 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100417 21:45581379-45581401 TTCTGGGGGATGCGGCACCGGGG No data
1180100406_1180100410 -3 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100410 21:45581362-45581384 ATGAACTGGGAGCGATATTCTGG No data
1180100406_1180100414 6 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100414 21:45581371-45581393 GAGCGATATTCTGGGGGATGCGG No data
1180100406_1180100419 26 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100419 21:45581391-45581413 CGGCACCGGGGCTTAGAGCAGGG No data
1180100406_1180100415 12 Left 1180100406 21:45581342-45581364 CCCATGTGGATGAGGAGATCATG No data
Right 1180100415 21:45581377-45581399 TATTCTGGGGGATGCGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180100406 Original CRISPR CATGATCTCCTCATCCACAT GGG (reversed) Intergenic
No off target data available for this crispr