ID: 1180100457

View in Genome Browser
Species Human (GRCh38)
Location 21:45581559-45581581
Sequence TGTCCTCGGGAACTGGCTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180100448_1180100457 17 Left 1180100448 21:45581519-45581541 CCCACGGCTGGGCTGATGGGCAG No data
Right 1180100457 21:45581559-45581581 TGTCCTCGGGAACTGGCTTATGG No data
1180100447_1180100457 18 Left 1180100447 21:45581518-45581540 CCCCACGGCTGGGCTGATGGGCA No data
Right 1180100457 21:45581559-45581581 TGTCCTCGGGAACTGGCTTATGG No data
1180100450_1180100457 -6 Left 1180100450 21:45581542-45581564 CCTGCACCAGAGCCACCTGTCCT No data
Right 1180100457 21:45581559-45581581 TGTCCTCGGGAACTGGCTTATGG No data
1180100444_1180100457 26 Left 1180100444 21:45581510-45581532 CCGGTGTGCCCCACGGCTGGGCT No data
Right 1180100457 21:45581559-45581581 TGTCCTCGGGAACTGGCTTATGG No data
1180100449_1180100457 16 Left 1180100449 21:45581520-45581542 CCACGGCTGGGCTGATGGGCAGC No data
Right 1180100457 21:45581559-45581581 TGTCCTCGGGAACTGGCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180100457 Original CRISPR TGTCCTCGGGAACTGGCTTA TGG Intergenic
No off target data available for this crispr