ID: 1180101797

View in Genome Browser
Species Human (GRCh38)
Location 21:45590918-45590940
Sequence CCTGAGCACCGCCCGGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180101792_1180101797 7 Left 1180101792 21:45590888-45590910 CCGAGAGGGTCTGGGGCGGTCAG No data
Right 1180101797 21:45590918-45590940 CCTGAGCACCGCCCGGGTGCAGG No data
1180101791_1180101797 8 Left 1180101791 21:45590887-45590909 CCCGAGAGGGTCTGGGGCGGTCA No data
Right 1180101797 21:45590918-45590940 CCTGAGCACCGCCCGGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180101797 Original CRISPR CCTGAGCACCGCCCGGGTGC AGG Intergenic
No off target data available for this crispr