ID: 1180103571

View in Genome Browser
Species Human (GRCh38)
Location 21:45601816-45601838
Sequence CAAGTGGCCGGCTGGGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180103571 Original CRISPR CAAGTGGCCGGCTGGGGAGG GGG (reversed) Intergenic
900187564 1:1339540-1339562 CACGGGGCGGGATGGGGAGGGGG - Intronic
900349462 1:2227873-2227895 GAAGAGCCCGGCTGGGGAGCGGG + Intergenic
900409125 1:2504922-2504944 CCTGGGCCCGGCTGGGGAGGGGG + Exonic
900429856 1:2596383-2596405 CCAGTGGCCGGCTGGGGTCAGGG + Intronic
900945091 1:5826599-5826621 CAAGTTGAAGTCTGGGGAGGAGG + Intergenic
901207800 1:7507378-7507400 CAGGCTGCAGGCTGGGGAGGGGG + Intronic
901666189 1:10827636-10827658 CAAGGAGGGGGCTGGGGAGGGGG + Intergenic
902398799 1:16146379-16146401 TAAGTGGACGGTTGGGGTGGGGG - Intronic
902642450 1:17775418-17775440 CAAGCACCGGGCTGGGGAGGTGG + Intronic
904320507 1:29695104-29695126 CAAGTGGGAGGGTGGGCAGGGGG - Intergenic
904474341 1:30755235-30755257 CAAGTGGCAGGGTAGGGAGATGG + Intronic
904917078 1:33977795-33977817 CAAGAGGAAGGCTGGGGAGAGGG - Intronic
905429181 1:37909309-37909331 CAAGGAGCAGCCTGGGGAGGAGG - Intronic
905434394 1:37946843-37946865 CAATGGGCCTGCTGGGGCGGGGG - Intronic
905629596 1:39511238-39511260 CCAGATCCCGGCTGGGGAGGCGG + Exonic
905668163 1:39774952-39774974 CCAGATCCCGGCTGGGGAGGCGG - Exonic
905859691 1:41342075-41342097 CAAGGGGCAGGCCCGGGAGGGGG - Intergenic
906034272 1:42740878-42740900 CAAGGGGCCTGGTGGGGAGCTGG + Intergenic
906744614 1:48213036-48213058 CAAGGAGCAGCCTGGGGAGGTGG + Intergenic
906918407 1:50036608-50036630 GAACTTGCCGGCTGGGGCGGGGG + Intergenic
907197423 1:52698106-52698128 CACGTGGCGGGCGGGGGACGGGG - Intronic
907503654 1:54901913-54901935 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
907909151 1:58811840-58811862 CAGGAGGCTGGATGGGGAGGTGG + Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910546388 1:88423456-88423478 GCAGTGGCAGGCTGGGTAGGCGG - Intergenic
911070978 1:93831691-93831713 CAAGGAGCAGCCTGGGGAGGAGG - Intronic
912380659 1:109246454-109246476 CCAATGGCCTGCTGGGAAGGAGG - Intergenic
912746839 1:112252294-112252316 CAAGTGGCTGGCAGGGAGGGCGG - Intergenic
912877055 1:113370769-113370791 CATGTGCAGGGCTGGGGAGGTGG - Intergenic
912915807 1:113812994-113813016 GATGTGGCCGGATGGCGAGGAGG - Intergenic
915895141 1:159806335-159806357 CAAGTGGCCGGGTGGTTGGGTGG + Intronic
915916874 1:159945681-159945703 CAATTGGCCGCCGCGGGAGGGGG - Intergenic
915956746 1:160226627-160226649 AAAGTGGCCAGCTGGTGATGAGG - Intronic
916961444 1:169893711-169893733 GAAGGGGCCGGGCGGGGAGGAGG - Intronic
917930424 1:179818877-179818899 AGAGGGGCCAGCTGGGGAGGAGG - Intergenic
918144065 1:181740503-181740525 CAAGTGGCCTGGTGGGGGTGGGG + Intronic
918248920 1:182684583-182684605 CGAGTGAGCGGCAGGGGAGGGGG + Intergenic
918455320 1:184705684-184705706 CTATTGGGCGGCAGGGGAGGGGG + Intronic
919990294 1:202704631-202704653 CTAGGGGTGGGCTGGGGAGGAGG - Intronic
920218380 1:204377703-204377725 CCAGGCGCCGGCTGGGCAGGGGG + Intergenic
920385492 1:205568342-205568364 CACCTGGCCAGGTGGGGAGGAGG + Intergenic
920703065 1:208232239-208232261 TAAAGGGCCGGCTGGGGAGAGGG - Intronic
920901624 1:210114867-210114889 CAAGGAGCAGCCTGGGGAGGAGG + Intronic
920912560 1:210232574-210232596 CAGGGGGCGGGCTGGGGTGGGGG + Intergenic
921343336 1:214156164-214156186 CATGGGGGAGGCTGGGGAGGGGG - Intergenic
921534613 1:216330599-216330621 CAAGTAGCTGGCTGGGGGAGAGG + Intronic
922363644 1:224844542-224844564 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
922795307 1:228336821-228336843 TCAGTGGCCGGCAGGGCAGGAGG - Intronic
923002938 1:230022721-230022743 CAACTGGCAGGAAGGGGAGGAGG + Intergenic
923793484 1:237131400-237131422 CAAGTGATGGGGTGGGGAGGGGG + Intronic
924436883 1:244049454-244049476 GAGGGGGCCGGCGGGGGAGGGGG + Intronic
1062830127 10:599937-599959 CAAGAGGCCGGGTGTGCAGGAGG + Intronic
1063147868 10:3312823-3312845 CAAATGTCCTGCTGGGGAGATGG + Intergenic
1064672594 10:17731806-17731828 CATGGGGCAGGCTGGGGAAGAGG + Intergenic
1065099658 10:22321029-22321051 CACGTGACCCGCTGGGGGGGCGG + Intronic
1066299410 10:34083590-34083612 CAAGTGGATGCCTGGGGATGGGG + Intergenic
1066437454 10:35407308-35407330 CAAGGAGCAGCCTGGGGAGGAGG + Intronic
1067309908 10:45102887-45102909 GGAGTGTCCGGCTGGGGAAGGGG - Intergenic
1067487818 10:46668498-46668520 CAGAAGGCTGGCTGGGGAGGAGG - Intergenic
1067685641 10:48464876-48464898 CCAGTGGCCAGCTGGGAATGTGG - Intronic
1069911905 10:71765142-71765164 CACATGGCCTGCTGGGGAAGGGG - Intronic
1070559197 10:77553072-77553094 CGGGTGGCGGGGTGGGGAGGCGG + Intronic
1071524643 10:86351380-86351402 CACAGGGCAGGCTGGGGAGGTGG + Intronic
1072884430 10:99261245-99261267 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1073100461 10:101003817-101003839 CAGGTGCCCGCCTGGGGAGCTGG - Exonic
1073139908 10:101240137-101240159 CCTGGGGCTGGCTGGGGAGGAGG + Intergenic
1073427847 10:103466872-103466894 AAACTGGTCAGCTGGGGAGGAGG - Intergenic
1073928564 10:108546194-108546216 GGAGTGGGAGGCTGGGGAGGCGG + Intergenic
1074358216 10:112804329-112804351 CCAGTGGCTGGATGGGAAGGTGG - Intronic
1075017142 10:118918190-118918212 CAAGTTGCAGGCTGGTGAGTGGG - Intergenic
1075206403 10:120453167-120453189 CAGGTGGCGGGGTGGGGTGGCGG + Intergenic
1075921947 10:126220907-126220929 CATGTGGCCTGCTGGAGATGCGG - Intronic
1076853586 10:133104724-133104746 CGGGGGGGCGGCTGGGGAGGCGG - Intronic
1077165068 11:1131140-1131162 CACGAGGCAGGCAGGGGAGGGGG + Intergenic
1077500960 11:2909566-2909588 CATCTGGGCGGCTGGGGACGGGG - Exonic
1077508026 11:2941100-2941122 CCTGGGGCGGGCTGGGGAGGAGG + Intergenic
1077766477 11:5164364-5164386 CAAGGAGCAGCCTGGGGAGGAGG + Intronic
1077883259 11:6367439-6367461 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1079173818 11:18120815-18120837 CAAGGCAGCGGCTGGGGAGGTGG - Intronic
1079459801 11:20669602-20669624 CTAGCGGGCGGCGGGGGAGGTGG - Exonic
1080123401 11:28703105-28703127 CAAATGGCAGGCGGGGGAGGAGG - Intergenic
1080418448 11:32090914-32090936 CACGTCGCCAGCTGGGGTGGTGG - Exonic
1081612506 11:44571018-44571040 CAAGTTGCGGGGTGGGGCGGCGG - Intronic
1083144781 11:60750117-60750139 TAGCTGGCTGGCTGGGGAGGAGG - Intergenic
1083205535 11:61146566-61146588 CAAGGGGCTGGGAGGGGAGGAGG + Intronic
1083419972 11:62546947-62546969 GGAGTGGGCTGCTGGGGAGGGGG + Intronic
1083595188 11:63915666-63915688 GATGTGGCGGGCGGGGGAGGTGG + Intronic
1083596220 11:63919308-63919330 GAGGGGGCCAGCTGGGGAGGGGG - Intergenic
1083599556 11:63938609-63938631 CGATTGGCCGCCTGGGAAGGTGG + Intergenic
1084085127 11:66851473-66851495 CCAGTGGCAGGCTGTGGAAGAGG + Intronic
1084273406 11:68040467-68040489 GAAGTGACTGGCTGGGCAGGCGG + Intronic
1084429174 11:69101868-69101890 CAGGTGGCCGGCTGGCCTGGTGG - Intergenic
1084774045 11:71363966-71363988 GAGGAGGCAGGCTGGGGAGGTGG + Intergenic
1085452324 11:76642084-76642106 GAAGGGGCAGGCTGGGGAGATGG + Intergenic
1085784274 11:79437645-79437667 CTGGAGGCCGGCGGGGGAGGCGG + Intronic
1088544497 11:110946028-110946050 CAGGTGGCAGGTTGGGGTGGAGG + Intergenic
1088895763 11:114077216-114077238 CAGGCTGCAGGCTGGGGAGGGGG - Intronic
1089167606 11:116489064-116489086 CAAGTGGCAGCACGGGGAGGAGG - Intergenic
1089324808 11:117649851-117649873 CACTTGGCAGGCTGGGGCGGAGG - Intronic
1089359489 11:117876572-117876594 CAGGTAGGCGGCTGGGGAGGTGG - Exonic
1089690618 11:120184745-120184767 CACGTGTCCGGGTGGGGAGGAGG + Intronic
1090362640 11:126184242-126184264 CAAGAGGTCGGCCGGGCAGGGGG + Intergenic
1090829272 11:130409703-130409725 CACGTGGCAGGATGGAGAGGAGG - Intronic
1092826011 12:12399409-12399431 CAAGAGGCAGCCTGGGGTGGAGG + Intronic
1093533330 12:20193564-20193586 TAAGTGGTTGCCTGGGGAGGGGG - Intergenic
1094814079 12:34166746-34166768 GAACTGGCCGGCTGGCGAGACGG - Intergenic
1095102819 12:38201752-38201774 GAACTGGCCAGCTGGCGAGGCGG + Intergenic
1095960700 12:47832792-47832814 CAAGAGGCCAAGTGGGGAGGAGG - Intronic
1095968028 12:47882626-47882648 CAAGGGGCGGGGTGGGGGGGAGG - Intronic
1095968859 12:47887719-47887741 CAAGTGGCAGACAGAGGAGGTGG - Intronic
1098919810 12:76293095-76293117 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1099836187 12:87911449-87911471 CGAGGGGCAGCCTGGGGAGGAGG + Intergenic
1101399268 12:104373719-104373741 CAAGAGGTAGGCTGGGGATGAGG - Intergenic
1102193710 12:111009003-111009025 CAAGTGACTTGGTGGGGAGGGGG - Intergenic
1102289440 12:111686782-111686804 GAAGTGACAGGGTGGGGAGGAGG - Intronic
1102548733 12:113675383-113675405 CAATTAGCAGGCTGGGGCGGAGG + Intergenic
1103199147 12:119072370-119072392 CAAATGGCTGCCTGGGGAGAAGG - Intronic
1104067895 12:125320194-125320216 CAATGGCCCAGCTGGGGAGGAGG + Intronic
1104461741 12:128962080-128962102 CAAGTGGCGGGAGGTGGAGGGGG - Intronic
1104691253 12:130828024-130828046 CTAATGGGCTGCTGGGGAGGAGG - Intronic
1105465170 13:20633350-20633372 CCAATGGCTGGCTGGGGTGGGGG - Intronic
1105596311 13:21842655-21842677 CAAGTGACTGCCTGGGGTGGGGG + Intergenic
1106029899 13:25990560-25990582 CATGTGGCCAGCTGGGGCAGAGG + Intronic
1108082340 13:46749372-46749394 CCAGGGGCTGGGTGGGGAGGTGG + Intronic
1108115248 13:47120468-47120490 CAAGCAGCCAGCTGGGGCGGAGG + Intergenic
1116534865 14:46016450-46016472 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
1116703379 14:48266418-48266440 CAAGAAGCAGCCTGGGGAGGAGG + Intergenic
1117093634 14:52274548-52274570 CAAGTGGGGAGCTGGGAAGGTGG - Intronic
1117324081 14:54652981-54653003 ATAGTGGACGGCTGGAGAGGCGG - Intronic
1118870472 14:69737003-69737025 CAAGTGACGGGCAGGGGAGGGGG + Intronic
1119620938 14:76131361-76131383 GAGGGGGCGGGCTGGGGAGGGGG + Intergenic
1121144614 14:91573630-91573652 GAAGAGGCTGGCAGGGGAGGAGG + Intergenic
1122264579 14:100540647-100540669 CAAGTGGCCAGCGGGGGCAGTGG + Intronic
1122317248 14:100833407-100833429 AAAGTAGCCGGCTGTGGTGGTGG - Intergenic
1123036482 14:105473988-105474010 CCAGGGGGCGGCCGGGGAGGCGG - Intronic
1123145278 14:106123871-106123893 CAGGTGCACAGCTGGGGAGGAGG - Intergenic
1123882577 15:24689597-24689619 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
1124127227 15:26947056-26947078 GATGTGGCCTGCTGGGAAGGAGG - Intronic
1124431631 15:29613576-29613598 CCAGTGGATGGATGGGGAGGGGG - Intergenic
1124554496 15:30711946-30711968 CAAGGGGCTGGATGGAGAGGAGG + Intronic
1124676753 15:31693731-31693753 CAAGGGGCTGGATGGAGAGGAGG - Intronic
1125665434 15:41426707-41426729 CAGGAGGCCGGCGGGGGGGGGGG - Intronic
1126376326 15:48000543-48000565 CAGGAAGCCTGCTGGGGAGGAGG - Intergenic
1126698066 15:51342083-51342105 CAGGTGGGCGGCTGGGGGTGTGG + Intronic
1126823592 15:52528704-52528726 CAGCTGTCAGGCTGGGGAGGGGG - Intronic
1127054345 15:55116254-55116276 CAAGTAGCCAGCTTGGAAGGTGG + Intergenic
1127329265 15:57922825-57922847 AAAGTGGGCGGGTGTGGAGGGGG + Intergenic
1128482731 15:68054210-68054232 CTAGAGGCGGGCTGGGAAGGTGG + Exonic
1129107088 15:73317962-73317984 CAGGACGCCGGCTGGGAAGGAGG + Intergenic
1129644564 15:77419192-77419214 CCAGAGGCAGGCGGGGGAGGAGG + Intronic
1129808976 15:78490909-78490931 AGAGTGGCGGGGTGGGGAGGCGG + Intronic
1132340318 15:101074202-101074224 CAAGGAGCAGCCTGGGGAGGAGG - Intronic
1132394187 15:101460062-101460084 CATGTGGCTGTGTGGGGAGGAGG - Intronic
1133651310 16:7816368-7816390 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1133670118 16:8010413-8010435 CTAGTGGCCTACTGGGGAGAGGG - Intergenic
1133732616 16:8589902-8589924 GCGGTGGCCGGCTGGGGACGGGG - Intergenic
1134005911 16:10818683-10818705 GCAGTCGCAGGCTGGGGAGGGGG + Exonic
1134460642 16:14426640-14426662 CGATTGGCTGGCTTGGGAGGTGG + Intergenic
1138417042 16:56877658-56877680 CAGGCGGCCAGCTGGGCAGGGGG - Intronic
1138458656 16:57135215-57135237 CAAGGGGGCGGGTGGGAAGGAGG - Intronic
1138601876 16:58060426-58060448 CAAGTGGCCACCAGGGCAGGAGG + Intergenic
1139421760 16:66853504-66853526 CTAGTGGCCGGCTAGGCAGATGG - Exonic
1139545103 16:67646328-67646350 CGAGGGGCTGGCAGGGGAGGAGG + Intronic
1140092580 16:71850351-71850373 CAATTGCCCAGATGGGGAGGTGG - Exonic
1140363021 16:74360708-74360730 CAGGTGGTCGTCTGTGGAGGTGG - Intergenic
1141689468 16:85588143-85588165 CAAGAGGCCAGCTGGGGAGAGGG - Intergenic
1142139308 16:88465630-88465652 CCATTGGCCAGCTGGGGAGGGGG + Intronic
1142141041 16:88472997-88473019 CGAGGGGCCAGCTGGGCAGGAGG + Intronic
1142292690 16:89200197-89200219 CCCTTGGCCGGCTGGGGTGGGGG - Intronic
1142850139 17:2700825-2700847 CCTGTGGCAGGCAGGGGAGGGGG + Exonic
1143026665 17:3945191-3945213 CGACTGGCCGCCCGGGGAGGAGG - Intronic
1143200713 17:5111497-5111519 CAGGTGCCCGCCCGGGGAGGGGG + Intronic
1143917291 17:10303195-10303217 CAAGAGGCAGGCTGAGGAGGCGG - Exonic
1144737615 17:17563869-17563891 CCAGTGCCCTCCTGGGGAGGCGG - Intronic
1146525437 17:33563485-33563507 CCAGTGGTGGGCTGGGGATGGGG - Intronic
1147337984 17:39738528-39738550 AAAGAGGGCGGGTGGGGAGGAGG - Intronic
1147772878 17:42879702-42879724 CAAGTGTCAGGGTGGGGACGGGG - Intergenic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1150249755 17:63699233-63699255 TAAGTGCCCGGCTGGGTGGGAGG - Intronic
1150387525 17:64773634-64773656 CATGTGGCCTGCAGGGGAGTTGG + Intergenic
1151525980 17:74668407-74668429 CAAGTGGCAGGGCGGGGGGGGGG - Intergenic
1152643845 17:81459964-81459986 CAAGTGGCCAGGTGGGCGGGAGG + Intronic
1152738458 17:82008753-82008775 CATGTGCCCTGCTGGGGAGCAGG + Intronic
1155681484 18:28492108-28492130 GAAGTGGCAGGGTGGGGAGAAGG - Intergenic
1156223154 18:35074758-35074780 CTAGTGGAGGGGTGGGGAGGAGG - Intronic
1156545553 18:37960613-37960635 AAAGTTGCAGGATGGGGAGGGGG + Intergenic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1157564231 18:48668813-48668835 CAAGTGCCCCGCTGGGGACAAGG - Intronic
1157607152 18:48933083-48933105 CAAGAAGCGGGGTGGGGAGGCGG + Intronic
1158763683 18:60421890-60421912 CGAGAGCCCGGCTGGGGCGGTGG - Intergenic
1160672405 19:372433-372455 CAAGCAGCCTGCTGGGGATGTGG + Intronic
1160814173 19:1027733-1027755 CCAGTGGGCGTCGGGGGAGGGGG - Intronic
1161272719 19:3398808-3398830 CCAGCGCCCAGCTGGGGAGGGGG + Intronic
1161283198 19:3456644-3456666 CGAGAGGCCGGCTGGTGGGGTGG + Intronic
1161397525 19:4052480-4052502 CTCCTGGCCTGCTGGGGAGGGGG + Intronic
1161422183 19:4182120-4182142 CAAATGCCAGGCTGGGGAGTTGG - Intronic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1161611587 19:5246035-5246057 CACGCGGCGGACTGGGGAGGGGG + Exonic
1161628819 19:5341047-5341069 CACGTGGGCGGCTGGGGTGGTGG + Intergenic
1161703123 19:5805457-5805479 CAAGGGGCAGGCGGGGCAGGTGG + Intergenic
1161711941 19:5853739-5853761 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1162597321 19:11639580-11639602 CATGGGGCGGGCGGGGGAGGGGG - Intergenic
1162655635 19:12127202-12127224 AAATTAGCCGGCTGGGGTGGTGG - Intronic
1162954606 19:14091039-14091061 AAAGCGGCGGGCGGGGGAGGGGG + Intergenic
1164254738 19:23517506-23517528 CAAGTGGCCGGGGGTGGGGGGGG + Intergenic
1164800741 19:31074059-31074081 AAAGAGGCCGGCTGGGGCAGGGG + Intergenic
1165653801 19:37515455-37515477 AAATTGGCCGGGTGGGGTGGCGG - Intronic
1166211071 19:41306799-41306821 GAGGTGGAAGGCTGGGGAGGTGG - Exonic
1166368927 19:42290978-42291000 CAAGTGTGGGGCTGGTGAGGTGG - Exonic
1166395072 19:42433643-42433665 CATGTGGCAGGCTGTGGAGAGGG + Intronic
1167278685 19:48553943-48553965 CAGGTGCCTGGCTGGGGTGGGGG - Intronic
1167367397 19:49061931-49061953 CAATTGGCACACTGGGGAGGAGG + Exonic
1167902060 19:52629438-52629460 CAAGGAGCAGCCTGGGGAGGAGG - Intronic
1168339690 19:55615868-55615890 CAACGGGCTGGCGGGGGAGGTGG + Exonic
925171707 2:1754226-1754248 GGGGAGGCCGGCTGGGGAGGTGG - Intergenic
927708534 2:25311472-25311494 GGTGTGGGCGGCTGGGGAGGAGG + Intronic
928186514 2:29115622-29115644 GGAGCGGCCGGCTGGGGACGCGG - Exonic
928778212 2:34791364-34791386 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
930017829 2:46983130-46983152 CAAGTGGTAGGCCAGGGAGGTGG + Intronic
930858005 2:56039733-56039755 GAAGTGGCGAGCTGGGGATGAGG - Intergenic
931609020 2:64079246-64079268 CAAGGAGCAGACTGGGGAGGAGG + Intergenic
932339107 2:70948685-70948707 CACTAGGCCGGCCGGGGAGGAGG - Intronic
932414920 2:71567875-71567897 CCAGTGAGAGGCTGGGGAGGAGG - Intronic
933163643 2:79053054-79053076 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
933660815 2:84925888-84925910 CTGGTGGCCAGCTGTGGAGGTGG + Intergenic
936513142 2:113164663-113164685 CCAGGGGCCTGCAGGGGAGGAGG + Intronic
937305360 2:120867446-120867468 CAAGTGGCCGCCGAGGGAGGCGG - Intronic
937469447 2:122162776-122162798 CAAGGGGCAGGCTGGGGTGGCGG + Intergenic
937988981 2:127651835-127651857 CAGGTTGCTTGCTGGGGAGGTGG - Exonic
939135445 2:138287966-138287988 CAAGGGGTGGGATGGGGAGGAGG + Intergenic
939141014 2:138354638-138354660 TATGTGGCCAGCTGGGGAAGTGG + Intergenic
939460825 2:142493912-142493934 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
940107247 2:150114242-150114264 CGAGGGGCAGCCTGGGGAGGAGG - Intergenic
940182845 2:150954688-150954710 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
940675894 2:156724112-156724134 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
941906051 2:170716709-170716731 CAGGTGGGCGGCGGGGGCGGTGG - Exonic
943061489 2:183045539-183045561 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
944149241 2:196539483-196539505 AAATTGGCCGGCTGTGGTGGCGG + Intronic
944450345 2:199835983-199836005 GAAGTGGTTGGCTGGGGAGGGGG + Intronic
946389743 2:219408362-219408384 GAAGTTGGGGGCTGGGGAGGAGG + Intergenic
948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG + Intergenic
948910262 2:240999130-240999152 CAAGTGGCTGGCGGCGGCGGCGG - Intronic
948964540 2:241367309-241367331 GAAATGGCTGGCTGGGCAGGTGG - Intronic
949042365 2:241855196-241855218 CAACTGGCTGGGTGGGGTGGGGG + Intronic
1170890427 20:20370646-20370668 AGAGTGGCAGGGTGGGGAGGGGG - Exonic
1170962688 20:21039431-21039453 CAAGTGGCTGGTTTGGGAGGTGG - Intergenic
1171123640 20:22584615-22584637 CTAGTGGGGGGGTGGGGAGGAGG + Intronic
1171767099 20:29296485-29296507 CGAGGGGCAGGCTGGCGAGGAGG + Intergenic
1172126346 20:32627239-32627261 CAAGTGGCAGGAGGGGGATGTGG - Intergenic
1172439027 20:34952402-34952424 CAAGAGGCCTGATGGGAAGGAGG + Intronic
1172624042 20:36337312-36337334 CCAGCGGCAGGCTGTGGAGGGGG + Intronic
1173885752 20:46457609-46457631 CAGGAGGCCGGCTGCGGGGGAGG - Intergenic
1174357118 20:50005860-50005882 GAAGTGGGAGGCCGGGGAGGAGG + Intergenic
1174804398 20:53593574-53593596 GCAGGAGCCGGCTGGGGAGGGGG + Intronic
1175179128 20:57132620-57132642 CGGGTGGCAGGTTGGGGAGGTGG + Intergenic
1175497402 20:59424141-59424163 CCAGTGGAGGGTTGGGGAGGGGG + Intergenic
1175825592 20:61934811-61934833 CAAGTGTCAGGTTGGGCAGGTGG - Intronic
1176088188 20:63307478-63307500 CTGGGGGCCGGCTGGGGCGGTGG - Exonic
1176129858 20:63492131-63492153 GAAGTGGATGGATGGGGAGGTGG + Intronic
1176240432 20:64073487-64073509 CCATTGGCTGCCTGGGGAGGAGG + Exonic
1176520238 21:7818807-7818829 CCAGTGGCTGGATGTGGAGGAGG - Exonic
1178544277 21:33480030-33480052 CAAGTGGCCGGCCGGGGGCGGGG + Intergenic
1178544309 21:33480134-33480156 CAAGTGGCCGGCCGGGGGCAGGG + Intergenic
1178654264 21:34448819-34448841 CCAGTGGCTGGATGTGGAGGAGG - Intergenic
1178922989 21:36751556-36751578 CAAGTGGCCGACTGGGGTGCGGG - Exonic
1179511558 21:41877207-41877229 CAGGTGGCGGGCAGGGGATGGGG - Intronic
1179650465 21:42805104-42805126 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180560318 22:16610005-16610027 GCAGGAGCCGGCTGGGGAGGGGG + Intergenic
1180922904 22:19531047-19531069 CAAGAGGCCGAGTGGGGAGCAGG + Intergenic
1181058687 22:20271776-20271798 TGAGTGGGCGGCTGGGGATGTGG + Intronic
1181956170 22:26589556-26589578 GAAATCGTCGGCTGGGGAGGTGG - Intronic
1181988200 22:26816444-26816466 CAAGTGGGTGGCCGTGGAGGGGG + Intergenic
1182153454 22:28047652-28047674 CAAGTGGGTGGCAGAGGAGGTGG + Intronic
1182257761 22:29050537-29050559 CAGGTGGCCCGCGGGGGCGGAGG + Exonic
1182696742 22:32203575-32203597 CCAGTGGCTGGGTGGGGAGGCGG - Intergenic
1183042440 22:35192434-35192456 CAAGTGTCCGGCTGCAGAAGAGG - Intergenic
1183063802 22:35350312-35350334 GAAGTGGCCGGTCTGGGAGGTGG - Intergenic
1183535424 22:38398256-38398278 GCAGGAGCCGGCTGGGGAGGGGG + Intronic
949285376 3:2396477-2396499 AATGTGGGAGGCTGGGGAGGGGG - Intronic
949888174 3:8712793-8712815 CCAGGGGCTGCCTGGGGAGGTGG - Intronic
950998948 3:17535706-17535728 AAAGTTGCGGGATGGGGAGGAGG + Intronic
951889080 3:27552207-27552229 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
953453715 3:43025149-43025171 CAAGTGGCCTGCAGAGGAGCAGG + Intronic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953599536 3:44349074-44349096 CAAGGAGCAGCCTGGGGAGGAGG + Intronic
954397293 3:50299509-50299531 TATGGGGCCGGGTGGGGAGGAGG - Intergenic
955818959 3:62875557-62875579 CACGAAGCCGGCAGGGGAGGAGG - Intergenic
958676910 3:97277029-97277051 CAAGGAGCAGCCTGGGGAGGAGG + Intronic
961481470 3:127183514-127183536 CAAATGGCAGGCTGGGGCAGTGG - Intergenic
961661315 3:128470116-128470138 CATGTGGCTGGGTGGGGGGGTGG - Intergenic
961786171 3:129348110-129348132 CAAGAGGCGGGCTGGGGGAGAGG + Intergenic
962941095 3:140125395-140125417 CAAGTAGCCGGGTGGGCATGGGG + Intronic
963111939 3:141695339-141695361 CAAGGAGCAGTCTGGGGAGGAGG + Intergenic
963319642 3:143798914-143798936 CAAGGAGCAGCCTGGGGAGGAGG - Intronic
963425125 3:145114612-145114634 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
968483499 4:847822-847844 CCAGTGGCCGGCTGGGAAGATGG + Intergenic
968593983 4:1473077-1473099 CAGGTGGCAGGGTGGGCAGGTGG - Intergenic
968599041 4:1500567-1500589 CGGGTGGCGGGCTGGGCAGGTGG - Intergenic
968654207 4:1771686-1771708 CATCGGGCCGGCTGGGGTGGGGG - Intergenic
968661437 4:1800347-1800369 CAAGTTGTAGGGTGGGGAGGTGG + Intronic
973644583 4:52937259-52937281 CAAGTGGCTGGCTGAGGGGTAGG + Intronic
975416708 4:74113136-74113158 CAAGTGGTGGAATGGGGAGGAGG + Intergenic
976740049 4:88347804-88347826 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
977782535 4:100995861-100995883 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
977937913 4:102827360-102827382 CCAGTGGCCGGCCGGGTAAGAGG - Intronic
978130918 4:105196305-105196327 CAAGTGGTGAGGTGGGGAGGGGG - Intronic
979054714 4:115979701-115979723 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
979798390 4:124876063-124876085 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
980094444 4:128474845-128474867 AAAGTGGCCTGATGAGGAGGTGG + Intergenic
981407430 4:144387371-144387393 AAAGTGGGGGGATGGGGAGGTGG - Intergenic
984087576 4:175331491-175331513 CTAGTGGCCAGAAGGGGAGGTGG - Intergenic
984165446 4:176298903-176298925 CAAGAAGCAGCCTGGGGAGGAGG + Intergenic
984758408 4:183343983-183344005 GCAGGGGCTGGCTGGGGAGGAGG + Intergenic
984964208 4:185127089-185127111 AAAGTGGCAAGCGGGGGAGGGGG - Intergenic
985079100 4:186246215-186246237 CAAGGAGCAGCCTGGGGAGGAGG + Intronic
985353830 4:189096278-189096300 CCACTGGCCGGCTGGGCACGCGG + Intergenic
985646622 5:1088039-1088061 CAGGCAGCGGGCTGGGGAGGGGG - Intronic
985680319 5:1252715-1252737 CAGGTGGGAGGCAGGGGAGGAGG + Intergenic
985895717 5:2749160-2749182 CACGTGGCCGGGTGGGGGCGAGG - Intronic
987132427 5:14871882-14871904 CCGGGGGCGGGCTGGGGAGGGGG + Intergenic
987381349 5:17288819-17288841 CCAGGAGCCAGCTGGGGAGGGGG + Intergenic
990458520 5:56012278-56012300 AAGGTGGCAGGCTGCGGAGGTGG + Intergenic
990793773 5:59516276-59516298 AAAGTGACTGCCTGGGGAGGAGG - Intronic
991189530 5:63853270-63853292 CAAGTGGGCGGGTGGGGAGGAGG + Intergenic
991543025 5:67750811-67750833 CAACTAGCTGTCTGGGGAGGTGG - Intergenic
996385020 5:122901800-122901822 CAAATGGGCTGCTGTGGAGGAGG - Intronic
998446946 5:142205872-142205894 CTAGTGGCCAGGAGGGGAGGTGG - Intergenic
999302397 5:150499341-150499363 GAAATGGCTGGCTGGGGATGGGG - Intronic
999424106 5:151471979-151472001 GAAGGGGCAGGGTGGGGAGGAGG - Intronic
1000043886 5:157505633-157505655 CAAGAGGGAGGATGGGGAGGAGG - Intronic
1001266504 5:170278310-170278332 AGAGTGGGGGGCTGGGGAGGGGG + Intronic
1001433340 5:171680686-171680708 CCTGTGGCTGGCTGGGAAGGTGG + Intergenic
1001674061 5:173497898-173497920 CAAGTGGCCGGCTGTGGGATGGG + Intergenic
1003121264 6:3320598-3320620 GAAGTGGCCCGCTGTGGAGAGGG - Intronic
1003426825 6:6003373-6003395 CGAGTGGCGGACAGGGGAGGAGG - Intronic
1003873754 6:10420008-10420030 CTCGTGGGCGGGTGGGGAGGCGG - Intergenic
1006311308 6:33262887-33262909 CTAGTGGAAGGCTGGGGAGAAGG + Intronic
1006388306 6:33744640-33744662 CCAGTGGCTGGGTGAGGAGGTGG - Intronic
1007211660 6:40197391-40197413 CAAGTGGTTTGCTGGGGATGTGG - Intergenic
1007615893 6:43179662-43179684 CAGGGGGCCAGCTGGGGAGATGG + Exonic
1007697817 6:43744736-43744758 CATTTGGCCGGCAGGGGAGAAGG + Intergenic
1007751095 6:44072609-44072631 CAAGTGGGTGGCCGGGGGGGGGG - Intergenic
1007763834 6:44149769-44149791 CAAGGGCCCAGCTGGGGAGGAGG + Intronic
1007789446 6:44300809-44300831 CATGTGCCCAGCTGGGAAGGGGG - Intronic
1008476426 6:51939810-51939832 CAAGGAGCAGCCTGGGGAGGAGG - Intronic
1010071818 6:71752626-71752648 CGAGGGGCAGCCTGGGGAGGAGG + Intergenic
1012314333 6:97767201-97767223 CAGGGGGCAGGGTGGGGAGGGGG - Intergenic
1013106606 6:107031228-107031250 AAAGTGGCCGGGTGTGGTGGTGG + Intronic
1013667960 6:112367120-112367142 CAGGTGGCCGGCGGCAGAGGCGG + Intergenic
1014051337 6:116958939-116958961 CACGTAGCTGGCTGGGTAGGAGG + Intergenic
1017024857 6:150172805-150172827 CATCTGGCCTCCTGGGGAGGAGG - Intronic
1017713992 6:157195388-157195410 CAACTGGCATGCTGTGGAGGGGG - Intronic
1017719412 6:157234550-157234572 CCAGTGGCCGGCTGGGCACGTGG - Intergenic
1017737866 6:157380738-157380760 CACGCGCCCAGCTGGGGAGGAGG + Intergenic
1018452201 6:163919500-163919522 CACGTGGCAGGGAGGGGAGGAGG + Intergenic
1019613202 7:1947238-1947260 CAAGGTCCCTGCTGGGGAGGAGG + Intronic
1020006212 7:4784953-4784975 CAGGCGGCCGGCAGAGGAGGTGG - Exonic
1021958179 7:25847412-25847434 CAACTGGCCTGCAGGGGAGGCGG - Intergenic
1022497626 7:30862995-30863017 GGATTGGCAGGCTGGGGAGGGGG - Intronic
1023545716 7:41316005-41316027 CATGGGGCAGGCTGGGGAGGGGG + Intergenic
1023658612 7:42451014-42451036 CAAGTTGCCAGGTGGTGAGGAGG + Intergenic
1023821644 7:43983936-43983958 CAGGGGGCAGGCTGGGGAGAGGG + Intergenic
1023999060 7:45179042-45179064 CCAGTGTCCAGCTGGGGTGGAGG - Intronic
1028762355 7:94509960-94509982 CAGGTGGCGGCCTGGGGAGCTGG + Exonic
1029364553 7:100108343-100108365 TCCGTGGCCGGGTGGGGAGGAGG - Intronic
1029749904 7:102537355-102537377 CAGGGGGCAGGCTGGGGAGAGGG + Intergenic
1029767854 7:102636461-102636483 CAGGGGGCAGGCTGGGGAGAGGG + Intronic
1032436689 7:131906679-131906701 CAAGGGGAAGGCTGGAGAGGTGG - Intergenic
1033570916 7:142627450-142627472 CAGGGGGCCCGCTGGGGCGGAGG - Intergenic
1033625486 7:143106478-143106500 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1035125446 7:156605506-156605528 CAAGTGGTGGCCAGGGGAGGGGG - Intergenic
1035205432 7:157291416-157291438 CCAGTGGAGGGCAGGGGAGGAGG + Intergenic
1035284882 7:157799749-157799771 GAGGGGGCCGGCTCGGGAGGTGG - Intronic
1035360517 7:158310549-158310571 CAAATGGCCGGCCGGAGATGGGG + Intronic
1036214248 8:6865986-6866008 CCCCTGGCCAGCTGGGGAGGGGG + Intergenic
1036434755 8:8723265-8723287 CCAGTGGCTGGGAGGGGAGGTGG - Intergenic
1036480353 8:9133855-9133877 CAAGTGGCCGGGTTGGGGGTCGG - Intergenic
1036728859 8:11243997-11244019 CACGAGGCAGCCTGGGGAGGAGG + Intergenic
1036781606 8:11651651-11651673 CACGTGGCGGGGTGTGGAGGCGG - Intergenic
1037887452 8:22602336-22602358 CAGGTGGTGGGCTGGGGTGGGGG + Intronic
1038820007 8:30943493-30943515 CTAGTGGCCAGGAGGGGAGGGGG + Intergenic
1041181358 8:55252475-55252497 CGGGTAGCTGGCTGGGGAGGAGG + Intronic
1043566781 8:81558004-81558026 CAGGAGGCCAGCTGGGGAAGAGG + Intergenic
1043927443 8:86053269-86053291 CAAGTGGCAAGCTGGGGAGATGG - Intronic
1045417065 8:101978006-101978028 CAAGGGGCTTGTTGGGGAGGGGG - Intronic
1049621294 8:143599466-143599488 CAAGTGCCTGGCTCCGGAGGAGG + Exonic
1049725297 8:144142924-144142946 CAGGCAGCTGGCTGGGGAGGCGG + Intergenic
1052653237 9:31328042-31328064 CAAGGGGTAGCCTGGGGAGGAGG - Intergenic
1052854883 9:33401097-33401119 CGAGTGGGTGGGTGGGGAGGAGG + Intronic
1053682902 9:40497426-40497448 CGAGTGGGTGGGTGGGGAGGAGG + Intergenic
1053932883 9:43125740-43125762 CGAGTGGGTGGGTGGGGAGGAGG + Intergenic
1054280812 9:63127502-63127524 CGAGTGGGTGGGTGGGGAGGAGG - Intergenic
1054394018 9:64637421-64637443 CGAGTGGGTGGGTGGGGAGGAGG + Intergenic
1054428667 9:65142633-65142655 CGAGTGGGTGGGTGGGGAGGAGG + Intergenic
1054501712 9:65878909-65878931 CGAGTGGGTGGGTGGGGAGGAGG - Intronic
1054793574 9:69277923-69277945 AGAGTGGTAGGCTGGGGAGGGGG + Intergenic
1055028526 9:71748314-71748336 CAAGTGGGTAGCTGGGAAGGTGG - Intronic
1057484962 9:95475630-95475652 CAAGTGGGCAGCGGGAGAGGGGG + Intronic
1058601447 9:106675067-106675089 CAAATGGAAGGCTGGGGATGAGG - Intergenic
1060495426 9:124115017-124115039 CAATGGGACAGCTGGGGAGGAGG - Intergenic
1060756609 9:126218721-126218743 CAAGTGGAGGGGTGGGGAGAGGG + Intergenic
1060770099 9:126326584-126326606 CGAGGGGGAGGCTGGGGAGGCGG + Intergenic
1060927352 9:127464221-127464243 GAAAGGGCCGGCTGGGGAGATGG + Intronic
1061591480 9:131600499-131600521 CAGGAGGCAGGCTGGGCAGGTGG + Intronic
1062070773 9:134553968-134553990 GAAGAGGAAGGCTGGGGAGGGGG + Intergenic
1062157202 9:135058785-135058807 TAAATGGCCAGCTAGGGAGGAGG + Intergenic
1062288083 9:135782337-135782359 GAGGTGGACGGCAGGGGAGGTGG - Intronic
1062363914 9:136199954-136199976 CAAGCGGCTGCCTGGGAAGGCGG + Intronic
1062380531 9:136284669-136284691 CGAGAGGCCGGCTGGGCAGGTGG + Intronic
1186783972 X:12941456-12941478 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1188520779 X:31035177-31035199 CAAGTGGCCAGATAGGTAGGAGG - Intergenic
1189234446 X:39476742-39476764 GAAGAAGCCGGCTGCGGAGGGGG + Intergenic
1190152069 X:47957205-47957227 GAGGTGGCCCGCTTGGGAGGAGG - Intronic
1190233896 X:48601606-48601628 AAAGGGGCTGGCTAGGGAGGTGG + Intronic
1190772430 X:53526634-53526656 CAAGGGGCGGGGTGGGGGGGGGG - Intergenic
1191014294 X:55792358-55792380 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
1192220984 X:69197200-69197222 CAGGTGGCTGGCGGGGGAGCTGG - Intergenic
1192454492 X:71265835-71265857 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1192914233 X:75636344-75636366 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
1195017050 X:100790502-100790524 CAAGGAGCAGCCTGGGGAGGAGG + Intergenic
1196037779 X:111166025-111166047 CAAGTGGCCTGCTGGCTAGAGGG - Intronic
1196047804 X:111274452-111274474 CAAGTGGTTGGCAGGGGCGGGGG + Intergenic
1196585018 X:117419291-117419313 CAAGGGGCAGCCTGGGGAGAAGG - Intergenic
1196976323 X:121161587-121161609 AAAGTGGCCTGCTGTGAAGGGGG - Intergenic
1197229262 X:123985823-123985845 CAAGAGGCTGGCTGTGGAGCAGG - Intronic
1198835543 X:140801047-140801069 CAAGTGCACGGGTGGGTAGGTGG - Intergenic
1200138708 X:153886778-153886800 CAGGTGGGCGGCAGGGTAGGAGG + Intronic
1201581302 Y:15514031-15514053 CAAGGAGCAGCCTGGGGAGGAGG - Intergenic
1201724905 Y:17140753-17140775 CAAGGAGCAGTCTGGGGAGGAGG + Intergenic
1201944862 Y:19500993-19501015 GAAGTGGCCTGCTGGAGAAGCGG - Intergenic