ID: 1180106772

View in Genome Browser
Species Human (GRCh38)
Location 21:45623762-45623784
Sequence CAGTGATGAGAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180106772_1180106777 19 Left 1180106772 21:45623762-45623784 CCTTCTTCCCTCTCTCATCACTG No data
Right 1180106777 21:45623804-45623826 GTGTCCCCCAGATTCATGTGTGG No data
1180106772_1180106778 20 Left 1180106772 21:45623762-45623784 CCTTCTTCCCTCTCTCATCACTG No data
Right 1180106778 21:45623805-45623827 TGTCCCCCAGATTCATGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180106772 Original CRISPR CAGTGATGAGAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr