ID: 1180108600

View in Genome Browser
Species Human (GRCh38)
Location 21:45637034-45637056
Sequence CCGGCACAGACTGCGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180108600_1180108612 27 Left 1180108600 21:45637034-45637056 CCTGCACCCGCAGTCTGTGCCGG No data
Right 1180108612 21:45637084-45637106 GTCCAGTAGCCCCCGGACCGCGG No data
1180108600_1180108610 20 Left 1180108600 21:45637034-45637056 CCTGCACCCGCAGTCTGTGCCGG No data
Right 1180108610 21:45637077-45637099 TCCGTGTGTCCAGTAGCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180108600 Original CRISPR CCGGCACAGACTGCGGGTGC AGG (reversed) Intergenic
No off target data available for this crispr