ID: 1180109441

View in Genome Browser
Species Human (GRCh38)
Location 21:45641262-45641284
Sequence TGACACACGCTGATCCGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180109441_1180109449 25 Left 1180109441 21:45641262-45641284 CCAGGCCGGATCAGCGTGTGTCA No data
Right 1180109449 21:45641310-45641332 GCTTTTTTTCTTCACAGGGTTGG No data
1180109441_1180109448 21 Left 1180109441 21:45641262-45641284 CCAGGCCGGATCAGCGTGTGTCA No data
Right 1180109448 21:45641306-45641328 AGCTGCTTTTTTTCTTCACAGGG No data
1180109441_1180109450 29 Left 1180109441 21:45641262-45641284 CCAGGCCGGATCAGCGTGTGTCA No data
Right 1180109450 21:45641314-45641336 TTTTTCTTCACAGGGTTGGCAGG No data
1180109441_1180109447 20 Left 1180109441 21:45641262-45641284 CCAGGCCGGATCAGCGTGTGTCA No data
Right 1180109447 21:45641305-45641327 GAGCTGCTTTTTTTCTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180109441 Original CRISPR TGACACACGCTGATCCGGCC TGG (reversed) Intergenic
No off target data available for this crispr