ID: 1180109726

View in Genome Browser
Species Human (GRCh38)
Location 21:45642445-45642467
Sequence CCCGCGGGTCCTCGCCGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180109726_1180109738 -3 Left 1180109726 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG No data
Right 1180109738 21:45642465-45642487 GGGGAAACGGGGCCCAGGCGCGG No data
1180109726_1180109743 20 Left 1180109726 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG No data
Right 1180109743 21:45642488-45642510 CGACTGCGGAGGACGCGCCTCGG No data
1180109726_1180109739 6 Left 1180109726 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG No data
Right 1180109739 21:45642474-45642496 GGGCCCAGGCGCGGCGACTGCGG No data
1180109726_1180109741 9 Left 1180109726 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG No data
Right 1180109741 21:45642477-45642499 CCCAGGCGCGGCGACTGCGGAGG No data
1180109726_1180109736 -8 Left 1180109726 21:45642445-45642467 CCACCCCGGCGAGGACCCGCGGG No data
Right 1180109736 21:45642460-45642482 CCCGCGGGGAAACGGGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180109726 Original CRISPR CCCGCGGGTCCTCGCCGGGG TGG (reversed) Intergenic
No off target data available for this crispr