ID: 1180110136

View in Genome Browser
Species Human (GRCh38)
Location 21:45643626-45643648
Sequence CTAGCGCCGCGCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180110136_1180110139 -3 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110139 21:45643646-45643668 TAGATTGGTTAGCGGCGCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 14
1180110136_1180110143 3 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110143 21:45643652-45643674 GGTTAGCGGCGCAGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 163
1180110136_1180110145 26 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110145 21:45643675-45643697 CCCGCGCCGCGCGCAGCGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 184
1180110136_1180110142 2 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110142 21:45643651-45643673 TGGTTAGCGGCGCAGAGGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 98
1180110136_1180110141 -1 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110141 21:45643648-45643670 GATTGGTTAGCGGCGCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180110136_1180110147 27 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110147 21:45643676-45643698 CCGCGCCGCGCGCAGCGCTCGGG 0: 1
1: 0
2: 0
3: 21
4: 194
1180110136_1180110140 -2 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110140 21:45643647-45643669 AGATTGGTTAGCGGCGCAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180110136 Original CRISPR CTAGCGCCGCGCGCCGCCGC CGG (reversed) Intergenic