ID: 1180110136

View in Genome Browser
Species Human (GRCh38)
Location 21:45643626-45643648
Sequence CTAGCGCCGCGCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180110136_1180110145 26 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110145 21:45643675-45643697 CCCGCGCCGCGCGCAGCGCTCGG 0: 1
1: 0
2: 2
3: 33
4: 184
1180110136_1180110147 27 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110147 21:45643676-45643698 CCGCGCCGCGCGCAGCGCTCGGG 0: 1
1: 0
2: 0
3: 21
4: 194
1180110136_1180110141 -1 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110141 21:45643648-45643670 GATTGGTTAGCGGCGCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180110136_1180110140 -2 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110140 21:45643647-45643669 AGATTGGTTAGCGGCGCAGAGGG 0: 1
1: 0
2: 0
3: 2
4: 33
1180110136_1180110142 2 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110142 21:45643651-45643673 TGGTTAGCGGCGCAGAGGGGCGG 0: 1
1: 0
2: 0
3: 10
4: 98
1180110136_1180110139 -3 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110139 21:45643646-45643668 TAGATTGGTTAGCGGCGCAGAGG 0: 1
1: 0
2: 0
3: 4
4: 14
1180110136_1180110143 3 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110143 21:45643652-45643674 GGTTAGCGGCGCAGAGGGGCGGG 0: 1
1: 0
2: 0
3: 12
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180110136 Original CRISPR CTAGCGCCGCGCGCCGCCGC CGG (reversed) Intergenic
901673099 1:10867296-10867318 CCCGCGCCGCCCGCGGCCGCCGG - Intergenic
902600944 1:17539856-17539878 CCAGCTCCGCAGGCCGCCGCGGG - Exonic
903153342 1:21428435-21428457 GTCGGGCGGCGCGCCGCCGCCGG - Intergenic
903193576 1:21669465-21669487 CTGCCGCCCCGCCCCGCCGCAGG + Intergenic
905639222 1:39576930-39576952 GTAGCGCCGCGCGGCCGCGCCGG - Intergenic
906517475 1:46448202-46448224 CTTCCGCCGCGCGCGGCCTCGGG + Intergenic
915171062 1:153977510-153977532 CTAGGGCCGCGAGCCCCCGCCGG - Exonic
915747773 1:158177932-158177954 CTGGCCCCGCGCCCCGCCCCAGG + Intergenic
921983713 1:221286001-221286023 CAAGCGCGGCGCGCAGCCCCGGG + Intergenic
922526639 1:226309239-226309261 GCAGCGCAGCGCGGCGCCGCGGG - Exonic
923007917 1:230067076-230067098 CTGGTGCCGCGCGGCGCCGCCGG + Intronic
923193478 1:231642247-231642269 CAAGCACCGCGCGCAGCCCCCGG + Intronic
1063504022 10:6580181-6580203 CCCGCGCCCCGCGCCGCCGCCGG - Intronic
1070610033 10:77926672-77926694 TGAGCGCCGCCCGCCGCCCCGGG - Intergenic
1071631600 10:87223025-87223047 CCTGCCCCGTGCGCCGCCGCAGG - Intergenic
1072169815 10:92848491-92848513 CCAGCGAGGCGCGGCGCCGCGGG - Intronic
1075054312 10:119206854-119206876 CCCGCGCCGCGCACCGCGGCCGG + Intergenic
1075802187 10:125160473-125160495 CTCGCTCCTCGGGCCGCCGCCGG + Intronic
1076639009 10:131901337-131901359 CCCGCGCCGCGCCCCGCCCCGGG + Intronic
1078371631 11:10751284-10751306 CTGCCGCCCCGCGGCGCCGCTGG - Exonic
1079035223 11:17014503-17014525 GGAGCGCCTCGCGGCGCCGCCGG - Intergenic
1080802270 11:35619245-35619267 CCAGCGCCACGTGCCGCCGCTGG + Exonic
1083607391 11:63986894-63986916 CTCACGGCGCGGGCCGCCGCTGG - Intronic
1083658448 11:64241393-64241415 CTAGCTCCGCCCCCCGCCGCCGG - Intronic
1090473977 11:127003538-127003560 CTTCCCCCGCGCGCCGCCCCCGG - Intergenic
1092184716 12:6470394-6470416 CTACCACCGCGCGCCGCTTCCGG - Intronic
1102933980 12:116881696-116881718 CTCGCGCTCCGCGCCTCCGCGGG - Intergenic
1104624445 12:130339712-130339734 CCAGCACAGCGCGCCGCCGTGGG + Intronic
1105472185 13:20704067-20704089 CAGGCGCCCCGCGCGGCCGCGGG + Exonic
1106516941 13:30464644-30464666 CTGGCTCCGCCCGCGGCCGCCGG + Intronic
1108541515 13:51451781-51451803 CTAGCGCGGCGCGGAGTCGCGGG - Intronic
1110450868 13:75636345-75636367 CTGGTGCCGCGCGCTGCCGCTGG + Intronic
1114656104 14:24316514-24316536 CGAGCGCAGCAGGCCGCCGCCGG - Exonic
1116945394 14:50831020-50831042 CAGGCGCCCGGCGCCGCCGCGGG + Exonic
1117722082 14:58638083-58638105 CCAGCGCCGCGCCCCGCCACAGG + Intronic
1119522163 14:75294363-75294385 CTCCCGCCGCGCCCCGCCCCCGG + Intergenic
1123215147 14:106802628-106802650 GTAGCCCCGCGCGCCCCTGCAGG + Intergenic
1124789923 15:32717950-32717972 CGGGCGCCGCGCTCTGCCGCCGG + Intergenic
1124999394 15:34754845-34754867 TCAGCGCCGCTCTCCGCCGCAGG + Exonic
1127268045 15:57376759-57376781 CCCGCGCCGCGCCCCGCCGAGGG + Intronic
1131826006 15:96322903-96322925 CGAGCGCCGCGCGTTGCTGCTGG - Intergenic
1132734703 16:1379652-1379674 CGGCCGCCCCGCGCCGCCGCCGG + Intronic
1132849850 16:2020091-2020113 CGCGCGCTGCGCGCGGCCGCCGG + Exonic
1133924786 16:10183399-10183421 ACAGCAGCGCGCGCCGCCGCAGG - Intergenic
1135135861 16:19884981-19885003 CTAGCCCCGCGCGGAACCGCCGG - Intronic
1136724793 16:32348935-32348957 CCAGCCGCGCGCGCCCCCGCGGG + Intergenic
1136843118 16:33554975-33554997 CCAGCCACGCGCGCCCCCGCGGG + Intergenic
1139826642 16:69762446-69762468 CCCGCGCCGCCCGCCGCCCCCGG - Intronic
1142206418 16:88785161-88785183 CGAGCGCTGCGCTCCGCCGAGGG - Exonic
1142374878 16:89701678-89701700 CGCGCGCCGCGCGCTTCCGCCGG + Exonic
1203001637 16_KI270728v1_random:168820-168842 CCAGCCGCGCGCGCCCCCGCGGG - Intergenic
1203133240 16_KI270728v1_random:1705226-1705248 CCAGCCGCGCGCGCCCCCGCGGG - Intergenic
1203153283 16_KI270728v1_random:1855273-1855295 CCAGCCACGCGCGCCCCCGCGGG + Intergenic
1143723964 17:8832888-8832910 CCACCGCAGCGCCCCGCCGCGGG + Exonic
1144565136 17:16353465-16353487 GCAGCGCGGCGCGCCCCCGCCGG + Exonic
1146022606 17:29292836-29292858 CCGGGGCCGCGCGCCGCCACCGG + Intronic
1147758939 17:42785216-42785238 ATAGGGCCGCGGGCCGCGGCGGG + Intronic
1148081146 17:44968217-44968239 CCAGCGCAGCGCGGCGCCCCGGG - Intergenic
1148332049 17:46818969-46818991 CTACCGCCGCGGTCCCCCGCTGG + Intronic
1148549441 17:48541908-48541930 CCAGCGCCTCGCGACGCTGCCGG + Intronic
1149430652 17:56593881-56593903 CACGCGCCCTGCGCCGCCGCCGG + Exonic
1150692609 17:67378373-67378395 CCAGCGCCGCCCTCCCCCGCTGG - Intronic
1151580115 17:74972759-74972781 CAAGCGGCGCGCCCCGCCCCCGG + Intronic
1151755786 17:76074658-76074680 CCAGCGCCGCCGGCCGCTGCTGG + Intronic
1152581176 17:81166191-81166213 CTGGCGCCGCGGGGCTCCGCTGG + Intergenic
1153457353 18:5295645-5295667 CTCGCACCGCGCCGCGCCGCTGG + Intronic
1153514309 18:5890706-5890728 GTAGCGGCGCGCGCCGCCAGGGG - Exonic
1158931159 18:62325753-62325775 CTTGCGCCGGGCGGTGCCGCGGG + Intronic
1159511494 18:69401776-69401798 CCAGCGCCGCGCGTCCCTGCCGG + Intronic
1160452966 18:78978535-78978557 CGAGCGCCGCGAGCCGCGCCAGG + Intergenic
1160691048 19:460833-460855 CCAGCCGCCCGCGCCGCCGCCGG + Exonic
1161721506 19:5905034-5905056 CTAGGGCGGCGCGCAGCTGCTGG - Exonic
1161779166 19:6279787-6279809 CTGGCGCCCCGCCCCGCCCCCGG + Exonic
1163480947 19:17555950-17555972 ATAGCGCCGTGCGCTCCCGCGGG - Exonic
926217049 2:10912214-10912236 CCAGCCCCGAGCCCCGCCGCCGG + Exonic
926285251 2:11482811-11482833 CGAGCGCCCCGCGCCGTGGCCGG + Intergenic
929460859 2:42101359-42101381 CGAGGCCCGCGCGGCGCCGCAGG + Intergenic
929539570 2:42809954-42809976 CCACAGCCGCGCGCCGCCACCGG + Intergenic
929701405 2:44166317-44166339 CCAGGGCCGCGCGCCGCTGCCGG + Intergenic
934529658 2:95077070-95077092 CTGGCGGCGCGCTCAGCCGCAGG - Intergenic
936141809 2:109947661-109947683 CGAGCGCCGCGCGCCCAGGCGGG + Intergenic
936178497 2:110245609-110245631 CGAGCGCCGCGCGCCCAGGCGGG + Intergenic
936202881 2:110423823-110423845 CGAGCGCCGCGCGCCCAGGCGGG - Exonic
938368843 2:130756268-130756290 CCGGCGCCGCGCGCCGCGGCCGG - Intronic
941240047 2:163026293-163026315 CAAGCGCCGCGCGCAGCCCCCGG - Intergenic
941476147 2:165953802-165953824 CTAGCGCCCCGGGCCCCAGCGGG + Exonic
941772767 2:169362199-169362221 CTAGGGCCGGGCGGCGGCGCGGG - Intronic
942151070 2:173076167-173076189 CTCGCTCCGGCCGCCGCCGCCGG - Intronic
1171123679 20:22584767-22584789 ATAGCGCGGCGCGCTGGCGCGGG + Intronic
1173691757 20:44966444-44966466 CCCGCGCCGCGCGCCGCTTCCGG + Intergenic
1173843645 20:46174787-46174809 CGAGCGCCACTCGCTGCCGCAGG - Exonic
1174264055 20:49318710-49318732 CAAGCGCCGCGCCCCGCCCTCGG - Intergenic
1175562309 20:59940439-59940461 CTGCCGCAGCGCGCCGCAGCCGG + Intronic
1176242083 20:64079885-64079907 CGAGCCACTCGCGCCGCCGCCGG + Intronic
1180110136 21:45643626-45643648 CTAGCGCCGCGCGCCGCCGCCGG - Intergenic
1180264160 21:46698962-46698984 GAGGCGCGGCGCGCCGCCGCAGG - Intergenic
1183524981 22:38317431-38317453 CTCGCACCGCGCGCGCCCGCCGG + Intronic
1183601527 22:38843211-38843233 TGAGCGCCGCGCGCCGTCGGGGG - Intronic
954031764 3:47824949-47824971 CGAGCGCCGCGCGCCCCCTGCGG - Intronic
954384258 3:50236165-50236187 CTACCGCCGCGCACCGACGGCGG - Exonic
954437351 3:50503251-50503273 CTACCGCTGCTCGCCGCCCCCGG - Exonic
955182162 3:56682833-56682855 CTCACGCCCAGCGCCGCCGCTGG + Exonic
965220927 3:165924647-165924669 CAAGCGCGGCGCGCAGCCCCGGG + Intergenic
966886621 3:184380633-184380655 CTCGCGCCGTGTGCCGCCCCGGG - Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968671675 4:1855676-1855698 CCAGCGCCGGGCGGAGCCGCTGG - Intronic
969378942 4:6782255-6782277 CTGCCGCCGCGCCCCGCCCCCGG - Intronic
971457936 4:26861330-26861352 CTATCGCCGGCCGCCGCGGCGGG - Exonic
972960615 4:44448266-44448288 CCGGCGCCGGGCGCCGCCACGGG + Exonic
978903285 4:113978871-113978893 CACGCGCCCCGCGCCGCTGCGGG + Exonic
984771924 4:183444207-183444229 CTTGAGCCGCCCGCAGCCGCGGG - Intergenic
984823598 4:183905668-183905690 CAAGGTCCCCGCGCCGCCGCCGG + Exonic
984999728 4:185471397-185471419 AAAGCGCCGCGCCCCGCCCCAGG - Intronic
985996945 5:3602378-3602400 CGCGCGCCACGCGCCGCAGCAGG + Intergenic
990456618 5:55994994-55995016 GGAGCGCCCCGCCCCGCCGCGGG - Intergenic
997470561 5:134114873-134114895 CCAGCGCCCCGCGCCCCGGCGGG + Exonic
1002638913 5:180621376-180621398 GGAGCGCGGCGCGCCTCCGCAGG + Intronic
1007781590 6:44257584-44257606 GCAGCGCCCCGGGCCGCCGCCGG + Intronic
1025739089 7:64182167-64182189 CCAGCGGCGCGGGCCGCAGCCGG + Intronic
1026853628 7:73739242-73739264 CTGGCGCCGCTCGCCCCCGCCGG - Intergenic
1034439989 7:151081484-151081506 CTTGCTCCCCGCGCCGCGGCGGG - Exonic
1038326761 8:26577741-26577763 CTCGCGCCGCCTGCCGCCCCCGG + Intronic
1041686840 8:60652269-60652291 CGCGCGCCGCGCGGCCCCGCAGG - Intergenic
1044819249 8:96144916-96144938 CGAAGGCCGTGCGCCGCCGCCGG + Exonic
1045269442 8:100649553-100649575 CGCGCACCGCCCGCCGCCGCAGG - Exonic
1049025907 8:139988692-139988714 ATAGACCCTCGCGCCGCCGCAGG - Intronic
1049405425 8:142450022-142450044 CGAGCGCCTCGCGTCGCCGGCGG - Exonic
1049570657 8:143368917-143368939 CTCGCGCAGCGCTCCGCAGCCGG - Exonic
1049693672 8:143973533-143973555 TAAGCGGCGCGCGCGGCCGCGGG - Intronic
1049762318 8:144336998-144337020 CGAGCGCCGAGCCCCGCCCCCGG - Intergenic
1049762659 8:144338110-144338132 CAAGTGCAGCGCGCCCCCGCAGG - Intergenic
1054835553 9:69672178-69672200 CTAGCGCCGCCTGCTCCCGCGGG - Exonic
1057758460 9:97854554-97854576 CAAGGGCCGGGCGACGCCGCGGG - Exonic
1057786072 9:98088046-98088068 CCAGCGCGGCGCCCCGCCCCCGG + Intronic
1059633910 9:116154278-116154300 CGACCCCCGCGCCCCGCCGCCGG + Exonic
1060700836 9:125747720-125747742 CTAGCCCCGGGCGCCACCCCGGG - Intronic
1061975716 9:134067361-134067383 CCGTCGCCGCGCGCCGCGGCCGG - Intronic
1061975964 9:134068159-134068181 CCGGCGCCGCGCCCCGCCCCGGG + Intronic
1187547340 X:20266865-20266887 CGAGAGCCTCGCGCCTCCGCTGG + Intronic
1190829017 X:54044050-54044072 CTGGCGCCGCGCGACCCAGCGGG - Intronic
1198005620 X:132489814-132489836 CTGGCTCCGCGCGCCGCTGCGGG + Intronic
1200239581 X:154486663-154486685 CTGGAACCGCCCGCCGCCGCCGG + Exonic