ID: 1180110141

View in Genome Browser
Species Human (GRCh38)
Location 21:45643648-45643670
Sequence GATTGGTTAGCGGCGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180110128_1180110141 22 Left 1180110128 21:45643603-45643625 CCTGCCCTTGGGCGGGGGCGGGG 0: 1
1: 0
2: 2
3: 61
4: 558
Right 1180110141 21:45643648-45643670 GATTGGTTAGCGGCGCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180110136_1180110141 -1 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110141 21:45643648-45643670 GATTGGTTAGCGGCGCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180110130_1180110141 18 Left 1180110130 21:45643607-45643629 CCCTTGGGCGGGGGCGGGGCCGG 0: 1
1: 0
2: 8
3: 82
4: 519
Right 1180110141 21:45643648-45643670 GATTGGTTAGCGGCGCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1180110132_1180110141 17 Left 1180110132 21:45643608-45643630 CCTTGGGCGGGGGCGGGGCCGGC 0: 1
1: 0
2: 17
3: 146
4: 877
Right 1180110141 21:45643648-45643670 GATTGGTTAGCGGCGCAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180110141 Original CRISPR GATTGGTTAGCGGCGCAGAG GGG Intergenic