ID: 1180110145 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:45643675-45643697 |
| Sequence | CCCGCGCCGCGCGCAGCGCT CGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 220 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 33, 4: 184} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180110136_1180110145 | 26 | Left | 1180110136 | 21:45643626-45643648 | CCGGCGGCGGCGCGCGGCGCTAG | 0: 1 1: 0 2: 0 3: 12 4: 129 |
||
| Right | 1180110145 | 21:45643675-45643697 | CCCGCGCCGCGCGCAGCGCTCGG | 0: 1 1: 0 2: 2 3: 33 4: 184 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180110145 | Original CRISPR | CCCGCGCCGCGCGCAGCGCT CGG | Exonic | ||