ID: 1180110147

View in Genome Browser
Species Human (GRCh38)
Location 21:45643676-45643698
Sequence CCGCGCCGCGCGCAGCGCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180110136_1180110147 27 Left 1180110136 21:45643626-45643648 CCGGCGGCGGCGCGCGGCGCTAG 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1180110147 21:45643676-45643698 CCGCGCCGCGCGCAGCGCTCGGG 0: 1
1: 0
2: 0
3: 21
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180110147 Original CRISPR CCGCGCCGCGCGCAGCGCTC GGG Exonic