ID: 1180110147 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:45643676-45643698 |
| Sequence | CCGCGCCGCGCGCAGCGCTC GGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 216 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 21, 4: 194} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1180110136_1180110147 | 27 | Left | 1180110136 | 21:45643626-45643648 | CCGGCGGCGGCGCGCGGCGCTAG | 0: 1 1: 0 2: 0 3: 12 4: 129 |
||
| Right | 1180110147 | 21:45643676-45643698 | CCGCGCCGCGCGCAGCGCTCGGG | 0: 1 1: 0 2: 0 3: 21 4: 194 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1180110147 | Original CRISPR | CCGCGCCGCGCGCAGCGCTC GGG | Exonic | ||