ID: 1180110386

View in Genome Browser
Species Human (GRCh38)
Location 21:45644640-45644662
Sequence CAGGCTGCTCTGAAGGACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180110386 Original CRISPR CAGGCTGCTCTGAAGGACGG TGG (reversed) Intronic
900181929 1:1314954-1314976 CAGGCAGCTCTGGAACACGGGGG + Exonic
900507745 1:3038208-3038230 CAGGCTGCTGGGCAGGAAGGGGG - Intergenic
900865132 1:5263309-5263331 CACACTGCTCTGAAGGGCAGAGG + Intergenic
901193322 1:7425497-7425519 GAGGCTGCTCTGAAGGACCCTGG - Intronic
902876207 1:19342370-19342392 GAGGCTCCTCTGAAGCATGGGGG + Intronic
903092374 1:20933133-20933155 CAGGATGCTGTGAAGGATTGGGG - Intronic
904567739 1:31437819-31437841 CAGGCTGCTCTGAAGGTTACAGG - Intergenic
906058511 1:42933690-42933712 CAGGCTGCTCTGAATGAGGGTGG + Intronic
907122909 1:52023269-52023291 CAGGCAGCTGTGAAGAACTGAGG - Intronic
907846732 1:58215314-58215336 CAGGCATCTCTGAGGGAGGGAGG - Intronic
909375252 1:74933535-74933557 CAGGCATCTCTGAAGGCCGGGGG + Intergenic
911045797 1:93626449-93626471 CAGGCTGATCTGCAGGCTGGGGG + Intronic
915195014 1:154182883-154182905 CACGGTCCTCTGAAGGCCGGCGG - Intronic
915462266 1:156077120-156077142 CAGGCTGTTCTGCCGGAAGGTGG + Exonic
916562389 1:165944248-165944270 CAGGCTGCCCTGATGGACACAGG + Intergenic
917505531 1:175623812-175623834 CAGGCTCCTCTGTAGTATGGGGG - Intronic
917849352 1:179047274-179047296 CAGGATGGTCTGGAGGAGGGAGG - Intronic
919062979 1:192657865-192657887 TAAGCTGCTCAGGAGGACGGGGG - Intronic
919991307 1:202710009-202710031 CCGGCTCCTCTGAGGGACTGGGG - Intronic
920264158 1:204709378-204709400 TAGTCTGCCCTGAAGGACTGTGG - Intergenic
924321419 1:242854826-242854848 GCGGCTGCTGTGAAGGATGGGGG + Intergenic
924629011 1:245719755-245719777 CAGGCTTTTCTGAAGGAAAGAGG - Intergenic
924855910 1:247874828-247874850 CAGGCTTCTGTGTAGGTCGGGGG + Intronic
1065976166 10:30844898-30844920 CACGAAGCTCTGAAGGAAGGTGG + Exonic
1067982042 10:51097684-51097706 TGAGCTGCTCTGAAGGAGGGCGG - Intronic
1068174984 10:53446660-53446682 CAGGCTGGACTGAATGAAGGAGG + Intergenic
1069656417 10:70092576-70092598 CAGACACCTCTGAAGGACCGAGG + Intronic
1069816058 10:71195204-71195226 CCAGCTCCTCTGAAGGAGGGAGG + Intergenic
1069842190 10:71346856-71346878 CAGGCTGCTGCGATGGAAGGGGG + Intronic
1070536612 10:77383151-77383173 CAGGGTTCTCTGAATGAGGGAGG - Intronic
1070745703 10:78932435-78932457 CAGGCTGTTTGGAAGGAGGGAGG - Intergenic
1073562239 10:104506752-104506774 AAGGCTGCTCTGGAGGAGGTCGG - Intergenic
1073582727 10:104682640-104682662 CAGGCTGCTCTGGAAGAGGTTGG + Intronic
1075082551 10:119393561-119393583 TAGACTGCTCTGCAGGACGCAGG - Intronic
1076033150 10:127176145-127176167 TAGGCTGCTCTGCAGGACACGGG + Exonic
1076124980 10:127966724-127966746 CAGGCTGCTCTGATGGCAAGAGG + Intronic
1076233164 10:128838731-128838753 CAGGCTGCCCTGAAGAGCGATGG - Intergenic
1076304385 10:129454076-129454098 TGGGCTGCTATGAAGGCCGGTGG + Intergenic
1076603902 10:131677181-131677203 CAGGCTGCTCTCAAAAACGGGGG - Intergenic
1076747777 10:132523018-132523040 CAGGCTGCTCTGAAGGTGCTGGG - Intergenic
1077040462 11:518879-518901 CCGGCCGCTCTGAGGGACCGGGG + Intergenic
1077144180 11:1037338-1037360 CAGGCTGCCCTGGAGGCCTGAGG + Intergenic
1077327326 11:1969410-1969432 CAGGCTGCCCGGAAGGAGGGTGG - Intronic
1078079237 11:8192228-8192250 CAGGCTGCCCTGAAGTCTGGAGG - Intergenic
1080224288 11:29943309-29943331 CAGGCTGCTCTGAATTATGCTGG - Intergenic
1084491502 11:69481116-69481138 GTGGCTGCTCTGACGGAAGGAGG - Intergenic
1084501862 11:69539879-69539901 CAGGCTCCTCTGCAGAACTGAGG + Intergenic
1084618199 11:70250684-70250706 CTGGCTGCTCAGTAGGATGGAGG + Intergenic
1085234839 11:75006322-75006344 CTGGCTGCTCTGGAGGAGGAGGG + Exonic
1085399288 11:76225947-76225969 CAGTCTGCCCTTAAGGAGGGAGG - Intergenic
1088658682 11:112025781-112025803 CAGTCAGCTCTGAAGGACAACGG - Intronic
1089062877 11:115640497-115640519 CAGGCTGCTGTGAAGCTGGGAGG - Intergenic
1089387841 11:118079652-118079674 CCGGCTGCTCTGGAGGAAGCTGG + Intronic
1089596854 11:119585926-119585948 CAGGCTGATGGGAAGGAAGGTGG - Intergenic
1090636933 11:128695080-128695102 GAGGCGGCTCCGAAGGACGCAGG - Intronic
1090650567 11:128802458-128802480 CAGGCTGCTGGGATGGACGTTGG + Intronic
1090865048 11:130692526-130692548 TAGCCTGCACTGAAGGAGGGAGG - Intronic
1091208401 11:133835966-133835988 CAGGCTGTGCCAAAGGACGGCGG - Intergenic
1202810308 11_KI270721v1_random:24590-24612 CAGGCTGCCCGGAAGGAGGGTGG - Intergenic
1092502851 12:9065169-9065191 CAGGCTGGGCTGATGGGCGGGGG - Intergenic
1092615652 12:10213305-10213327 CAGGCGGCTCTGGAGAAGGGAGG + Intronic
1096347873 12:50866447-50866469 GAGGCTGCTGTGAGGGATGGGGG - Intronic
1096476795 12:51913563-51913585 CCGGCTGCTCCGAAGGAGGTTGG - Exonic
1096783265 12:54002978-54003000 CTGGCTTCTCTGAAGAAAGGAGG - Exonic
1103613352 12:122137436-122137458 CAGACTCCTCTGAGGGGCGGAGG - Intronic
1103744305 12:123111664-123111686 CAGGCTCCTCTGTGGGACTGAGG + Intronic
1103912739 12:124361259-124361281 CAGGCTGCTCCAAAGGTCTGAGG - Intronic
1104602333 12:130162274-130162296 CAGGCTGGGCTGCAGGCCGGGGG + Intergenic
1106179649 13:27359683-27359705 CTGGCTGCTCTGGAGGCTGGAGG + Intergenic
1109227167 13:59711299-59711321 CAGGATGCTCAGAAGGGCTGTGG - Intronic
1114556301 14:23564256-23564278 CAGGAGGCTCTGGAGGAAGGAGG + Intronic
1114645974 14:24256327-24256349 CAGGCTGCTCTGCTGGAGGATGG + Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1122839594 14:104450846-104450868 CGTGCTCCTCTGCAGGACGGCGG - Intergenic
1122862653 14:104589440-104589462 ATGGCTGTTCTGAAGGTCGGGGG - Exonic
1122920177 14:104876704-104876726 CAGGCTGCTCTCAGGGAGAGTGG + Intronic
1124662370 15:31560765-31560787 CAGGCTGAACTGGAGGACAGTGG - Intronic
1129691432 15:77715855-77715877 CTGGCTGCTCTGAAGGGGGCTGG + Intronic
1129743456 15:78001547-78001569 CAGGCTGCTCTCAAGGAGGCAGG + Intronic
1129969913 15:79769179-79769201 CAGGCGGCCCTGAGGGATGGAGG - Intergenic
1131048895 15:89333727-89333749 CCGCCTGCTCTGGAGGAAGGTGG - Exonic
1131097985 15:89667785-89667807 CAGGCTGCTCTGAGGGAGGATGG + Exonic
1131657763 15:94479331-94479353 CTGGCTGTTCTCAAGGAAGGTGG - Exonic
1131763294 15:95647700-95647722 CCTGCTGCTTTGAAGGACGCAGG + Intergenic
1132087229 15:98918302-98918324 CAGGCTCCTCTCAGGGTCGGGGG - Intronic
1132753636 16:1471136-1471158 CAGGCAGCTCTGAAGGGCCTGGG + Intronic
1132866002 16:2093085-2093107 CAGGAGGCTCTGGTGGACGGGGG + Exonic
1135110117 16:19684116-19684138 CTGGGTGCTCTGGAGGAAGGAGG + Intronic
1137411265 16:48230305-48230327 CAGGCTGCTCTGAAGGGATTTGG + Intronic
1137974018 16:53015127-53015149 CAGGATGCTCTGCAGGGCTGAGG - Intergenic
1138563590 16:57816554-57816576 CTGGCTGCTCTGAGTGGCGGAGG + Intronic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1138979829 16:62254200-62254222 CAGGCTGCTGAAAAGGAGGGAGG - Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1141673001 16:85502686-85502708 CAGGCTCCCCTGCAGGTCGGCGG - Intergenic
1147157624 17:38552192-38552214 AAGGCTGCTCTGAGGGAGGTGGG + Intronic
1147237726 17:39070000-39070022 CAGGTTGTTCTGAAGGCCTGTGG + Exonic
1151459879 17:74248210-74248232 CTGGCTGCTCTGGAAGGCGGAGG + Intronic
1152278925 17:79373777-79373799 CAGCCTGCCCTGGAGGAAGGAGG - Intronic
1154980104 18:21496788-21496810 AAGGCTCCTCTGAAGGCCGTTGG - Intronic
1158299628 18:56036789-56036811 CAGGCTCCCCTGAAGAACAGAGG - Intergenic
1162494286 19:11014423-11014445 CAGACTGCTCTGAAGGAGCAGGG + Intronic
1163288654 19:16364685-16364707 CAGGCAGCTCTGGCGGGCGGGGG + Intronic
1165006804 19:32814190-32814212 ACGGCTGCTCTGCAGGATGGGGG - Intronic
1165319803 19:35078070-35078092 CAGGCTGCCATGATGGAGGGTGG + Intergenic
1166055065 19:40283749-40283771 AAGGCTGCTCTGAAGGGCTTGGG - Intronic
1166678563 19:44754149-44754171 CCTGGAGCTCTGAAGGACGGGGG + Intronic
1167439548 19:49500403-49500425 CAGGCTGCTGGGAAGGAAGTGGG + Intergenic
1168024199 19:53631939-53631961 CAGGGGGCTCTGGAGGACCGAGG + Intergenic
1168325558 19:55536933-55536955 CAGGCTCCCCTGAGGGACCGAGG + Intronic
925271622 2:2613735-2613757 GAGGGTGCTCTGAGGGGCGGGGG + Intergenic
926560234 2:14408740-14408762 CAGACTGCTCTGCAGGACCCGGG + Intergenic
927727602 2:25438687-25438709 CAGGCTTCTCTTAAGGAATGGGG - Intronic
927897575 2:26794263-26794285 GAGGCTACTCTGAAGGGCAGAGG - Exonic
930088834 2:47517315-47517337 GAGGCCTGTCTGAAGGACGGAGG + Exonic
932231186 2:70086116-70086138 CAGGCTGGTCTGAAGGTCGGAGG - Intergenic
933110747 2:78397224-78397246 GAGGCTGCTTTGAAGGATGGGGG - Intergenic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934572285 2:95380490-95380512 CAGGCTACTCTGAAAGAAAGGGG - Intronic
938727390 2:134120478-134120500 CCGGCCGCTCTGCAGGACGCCGG + Intronic
942451280 2:176109180-176109202 CAGGCTGGTGGGAAGGAGGGTGG - Exonic
945195903 2:207237606-207237628 CAGGCTGGTTTGAAGGACCAGGG - Intergenic
946735460 2:222750194-222750216 CAGGCTGCGGTGAACTACGGTGG - Intergenic
948479915 2:238242848-238242870 GAGGCTGCTGTGAAGGAGGGAGG - Intergenic
1169275716 20:4232509-4232531 CAGACTGCTCAGAAGGGCTGGGG + Intronic
1170178076 20:13495453-13495475 CACACTGCTCTGAAGGAGGAAGG + Intronic
1172299946 20:33842383-33842405 CTGGTTGCTCTGCTGGACGGAGG - Intronic
1174412207 20:50343565-50343587 CAGGAGGCTCTGAAGGAGGCAGG + Intergenic
1174557262 20:51404813-51404835 CACGCTGCTCTGCAGGTCGCCGG - Intronic
1174658358 20:52190849-52190871 CAGGCAGCTACGAAGGACAGCGG + Intronic
1175924721 20:62466108-62466130 CTGGCAGCTCTGTCGGACGGGGG - Intronic
1176258227 20:64164892-64164914 GAAACTGCTCTGGAGGACGGGGG + Intronic
1178506533 21:33167432-33167454 CAGGCTGCTGAGAAGCACTGGGG - Intronic
1178554126 21:33571927-33571949 CAAGGTGCTCTGATGGAAGGAGG - Intronic
1180110386 21:45644640-45644662 CAGGCTGCTCTGAAGGACGGTGG - Intronic
1180844783 22:18975136-18975158 CAGGCTGCTCTGAGTGAGGCTGG - Intergenic
1180871914 22:19150981-19151003 CAGGCGGCTCTGAAGCACCGAGG - Intergenic
1181056684 22:20263576-20263598 CAGGCTGCTCTGAGTGAGGCTGG + Intronic
1181386960 22:22553329-22553351 AAGGCTGTCCTGAAGGAAGGTGG + Intronic
1183367924 22:37417045-37417067 CAGGCGGCGCTGAGTGACGGTGG - Intronic
1184410722 22:44324729-44324751 CAGGCTGCTCTTGGGGAAGGAGG + Intergenic
1184643741 22:45885384-45885406 CAGGCTCCTGTGAAGGGCTGGGG - Intergenic
1185398174 22:50603209-50603231 GAGGCTGTCCTGCAGGACGGAGG - Exonic
954286994 3:49626126-49626148 CAGGATGCTTTGAATGACTGTGG + Intronic
955976161 3:64482291-64482313 CAGGATGCTCTGGAGGAGAGGGG + Intergenic
960526920 3:118720563-118720585 CAGGCTCCACAGAAGAACGGAGG - Intergenic
960884732 3:122382984-122383006 GAGGCTGCTCTGTAGGAGGAGGG - Intronic
961456788 3:127028447-127028469 CAGGCTGGTCTGGAGGGCAGTGG + Intronic
961543724 3:127617884-127617906 CAGGCTGCTCTGATGGCAGAAGG - Intronic
961682967 3:128611192-128611214 GTGGCTGCTCTGAGGGACTGGGG - Intergenic
966885498 3:184375888-184375910 CAGTCTGCTGTGAAGGACATGGG + Exonic
967184001 3:186930314-186930336 CTGCCTGCTCTCAAGGAGGGTGG - Intergenic
968450966 4:675764-675786 CAGGCTGATCTGAAAGTGGGTGG - Intronic
968514506 4:1010577-1010599 GAGGCTGCTCTGGGGGATGGAGG + Intronic
968554927 4:1242061-1242083 CAGGATGCACTGAGGGTCGGAGG - Intronic
969056998 4:4408289-4408311 CAGGCTGCTGGGAGGGGCGGTGG + Intronic
969376399 4:6766308-6766330 CAGGCTGCTGGGAACGAGGGTGG - Intergenic
969458156 4:7312813-7312835 CTGGCTGCTCTGCAGGTCAGGGG + Intronic
977191045 4:94001085-94001107 CAGGTTGTTCAGAAGGACAGCGG + Intergenic
979756498 4:124346598-124346620 CAGGGTGCTCAGAAAGACAGGGG - Intergenic
981742059 4:148013121-148013143 CAGGCTGCCCTGAAGGTGGGGGG - Intronic
985660490 5:1154823-1154845 TAGGCTGCTCTGAAGACCTGCGG - Intergenic
986146853 5:5086101-5086123 CAGACTGCTTTGAGGGACTGAGG + Intergenic
987663017 5:20902077-20902099 CAGTCTACTCTGAGGGAGGGAGG + Intergenic
989090156 5:37722048-37722070 CAGGAAGCTCTGAAGGAAGATGG - Intronic
992018702 5:72601064-72601086 CAGGCTGCTGTGAGGAACAGTGG + Intergenic
993076503 5:83238931-83238953 CAGGCAGCTCTGAAGTAGGCTGG + Intronic
993129601 5:83878766-83878788 GAGGCTGTTCTGAAAGACGTGGG - Intergenic
997283541 5:132663075-132663097 CAGGCTGCTCCCCAGGAAGGGGG + Intergenic
997587364 5:135051399-135051421 CAGCCTCATCTGAATGACGGTGG - Intronic
997633418 5:135386975-135386997 CAGGCTGCTGTGAAGGCCAAAGG - Intronic
997997501 5:138598273-138598295 CCGGCTGCTCTGAGGAAAGGCGG + Intergenic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
998133957 5:139665091-139665113 CTGGGTGCTCTGAAGGTCAGTGG - Intronic
999269395 5:150287779-150287801 GGGGCTGCTCTGGAGGACTGAGG - Intronic
999956920 5:156712767-156712789 AATGCTGCTCTGAAGGAAGAGGG - Intronic
999975531 5:156908414-156908436 CAGGCTTCTCTAAAGGAGAGTGG + Intergenic
1001561005 5:172668895-172668917 CATTCTGCTCTGAAGGACCTGGG - Intronic
1001875261 5:175194824-175194846 CAGGCAGCCCAGAAGGAGGGAGG + Intergenic
1002764615 6:228204-228226 CAGGCTGCCCCGCAGGATGGTGG + Intergenic
1005269283 6:24146099-24146121 CAGGCAGCTCTGCTGGAGGGCGG + Exonic
1005926783 6:30451506-30451528 CAGGAGGCTCTGAAGGAAGAGGG + Intergenic
1006387434 6:33739166-33739188 CAGGCTGCACTGAAGGCCCAGGG - Exonic
1006508073 6:34503522-34503544 CAGGCTGCTATGTTGGACTGTGG + Intronic
1007661589 6:43490086-43490108 CAGGCTGCGGGGAAGGATGGAGG - Intronic
1008594145 6:53024469-53024491 GAGGGTGCTCTGAAGAACAGAGG - Intronic
1011557603 6:88586796-88586818 CAGGCAGCTGGGAAGGGCGGGGG - Intergenic
1013817438 6:114115752-114115774 CAGGCTTCTATGATTGACGGTGG + Intronic
1017672060 6:156777993-156778015 GAGGCGGCTCTCAAGGAGGGTGG + Exonic
1017776954 6:157688111-157688133 CCTGCTGCTTTGAAGGACGTTGG - Intergenic
1018258592 6:161947550-161947572 CAGGCAGGTGTGAAGGAGGGAGG - Intronic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1020086213 7:5312283-5312305 CACTCTGCTCTGAAGGACTCGGG + Intronic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1024054674 7:45652351-45652373 GAGGCTGCTCTGATAGAGGGTGG + Intronic
1029197279 7:98814403-98814425 CAGGCAGCTCTGAAGAAGGATGG - Intergenic
1029632887 7:101764213-101764235 CAGGCTGGCCTGACGGATGGAGG - Intergenic
1031988099 7:128176837-128176859 AAGGCTCCTCTGAAGGACACGGG - Intergenic
1032367230 7:131310684-131310706 CAGACTGCTTTGAAGAATGGAGG - Intronic
1032452791 7:132047770-132047792 CAGGCTGTCTTGAAGGAGGGTGG - Intergenic
1033591074 7:142809013-142809035 CATGATGCTCTGAAGGTGGGTGG - Intergenic
1036048163 8:5166898-5166920 CAGGCTGCTGTGAATGACCCTGG - Intergenic
1036599685 8:10248898-10248920 CAGCCTGCTCTGAATCACAGTGG + Intronic
1037361710 8:18081308-18081330 CAGGGTGCGTTGAAGGATGGTGG - Intronic
1039143927 8:34423860-34423882 AAGGCTGCTGTGAACGACAGAGG - Intergenic
1039471350 8:37815446-37815468 CAGGCGGCTCTGAACCAGGGTGG - Intronic
1040906491 8:52474520-52474542 CAGGCTGCTGTTAAAGATGGGGG - Intergenic
1041931000 8:63286154-63286176 CAAGCTGCTTTGGAGGACAGAGG - Intergenic
1045248886 8:100466848-100466870 CAGGCTACTCGGAAGGCAGGAGG - Intergenic
1049510217 8:143023447-143023469 CAGGCTGCTCTGATGGGCTCCGG - Intronic
1050038782 9:1465516-1465538 CTAGCTGCTCTGAAGGGAGGGGG + Intergenic
1050437615 9:5627468-5627490 CAGGCTGCTGTGTTGGACTGGGG + Intergenic
1052274198 9:26659314-26659336 CAGGCTGCTTGGAAGGGAGGAGG - Intergenic
1052769727 9:32676518-32676540 CATGTTGCTCTGAAGGAGGTTGG + Intergenic
1055297319 9:74847504-74847526 CAGGCTGCTCTGATGGTAGTAGG + Intronic
1057773303 9:97984904-97984926 CAGGCCGCTCTCAAGCACGTGGG - Intronic
1058037906 9:100273247-100273269 GAGGCTGCAGTGAAGGACAGAGG + Intronic
1058646086 9:107132653-107132675 CTGGATGCTCTGTAGGGCGGGGG + Intergenic
1061887419 9:133598896-133598918 CAGGCTGCTCAGAACAAAGGTGG + Intergenic
1189379076 X:40488977-40488999 CAGGCGCCTCTGGAGGAGGGTGG - Intergenic
1192496961 X:71622635-71622657 CCAGCTGCTCTGGAGGGCGGAGG - Intergenic
1192927203 X:75767497-75767519 CAGGCAGCTCTGCAAGACAGAGG + Intergenic
1195019479 X:100812434-100812456 AAGGCTGCTGTGGAGGATGGGGG + Intergenic
1195718939 X:107847348-107847370 CAGGATGCTCTGAAGCACAGTGG + Intronic
1198106638 X:133468263-133468285 CAGGCAGCTCTGCAGGACACTGG + Intergenic
1199679677 X:150216027-150216049 CAGGCTGCTCTGCAGGGCTGGGG - Intergenic
1199695554 X:150341022-150341044 CAGGCTGCTCTGCAGGGCTGGGG + Intergenic
1199696508 X:150346319-150346341 CAGGCTGCTCTGAGAGGCAGTGG + Intergenic
1200326171 X:155242029-155242051 CAGTTTGCTCTGAAGGACATTGG + Intergenic