ID: 1180114406

View in Genome Browser
Species Human (GRCh38)
Location 21:45689242-45689264
Sequence ATAAGCCATCAGGACCAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 436}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180114406 Original CRISPR ATAAGCCATCAGGACCAAAT GGG Intronic
900699657 1:4037761-4037783 ATAAACCATCATGATCAAGTGGG + Intergenic
906085826 1:43133397-43133419 ATAATACATCATGACCAAGTAGG - Intergenic
906955999 1:50374579-50374601 ATAATCCACCATGATCAAATGGG + Intergenic
908139169 1:61165680-61165702 AGAAATGATCAGGACCAAATTGG - Intronic
908890490 1:68841838-68841860 ATAATCCATCATGATCAAGTGGG - Intergenic
909806564 1:79879943-79879965 CTAAACCACCATGACCAAATAGG + Intergenic
909892989 1:81031005-81031027 AGAAGCCATTAGGAACAAAGAGG - Intergenic
910141979 1:84036144-84036166 ATAATCCATCATGATCAAGTGGG - Intergenic
911343521 1:96669206-96669228 ATCAGTCATCATGACCAAGTGGG - Intergenic
911360483 1:96870062-96870084 ATAATACATCATGATCAAATGGG - Intergenic
912180743 1:107216496-107216518 ATAATCCATCATGATCAAGTGGG - Intronic
916369147 1:164069844-164069866 ATAATTCATCATGACCAAGTGGG - Intergenic
917377348 1:174363895-174363917 ATCATTCATCATGACCAAATGGG - Intronic
919111618 1:193226668-193226690 ATAATCCACCATGATCAAATGGG - Intronic
919376512 1:196801077-196801099 ATCATTCATCATGACCAAATGGG - Intergenic
919386210 1:196925990-196926012 ATCATTCATCATGACCAAATGGG - Intronic
919734824 1:200940767-200940789 ATAATACATCACAACCAAATGGG - Intergenic
919959652 1:202453330-202453352 ATAATTCATCATGACCAAGTGGG - Intronic
920968974 1:210726287-210726309 ATAAGCAAGCAGAAACAAATGGG + Intronic
921124073 1:212161516-212161538 AGAACCCAACAGGGCCAAATAGG + Intergenic
923617175 1:235547499-235547521 ATAAGCCATCAGCACCACACAGG - Intergenic
924935080 1:248761570-248761592 ATAATCCATCATGATCAAGTGGG + Intergenic
1064954744 10:20895191-20895213 ATAAACCATCAGGACTAAAGTGG - Intronic
1065227828 10:23563402-23563424 ATTAGACACCAGGACCAAGTCGG - Intergenic
1065470649 10:26077846-26077868 ATAATCCACCATGATCAAATGGG - Intronic
1066353593 10:34660746-34660768 AGATTCCATCAGTACCAAATAGG + Intronic
1066758606 10:38734728-38734750 ATAATTCATCATGATCAAATGGG - Intergenic
1066784522 10:38988596-38988618 ATAATCCACCATGATCAAATGGG + Intergenic
1067183781 10:44010010-44010032 AGAAACCAGCAGGACCAAACTGG - Intergenic
1067215935 10:44302989-44303011 ATCATTCATCATGACCAAATGGG + Intergenic
1067371655 10:45689304-45689326 ATAATCCACCATGATCAAATGGG + Intergenic
1067388126 10:45836845-45836867 ATAATCCACCATGATCAAATGGG - Intronic
1067417999 10:46120435-46120457 ATAATCCACCATGATCAAATGGG + Intergenic
1067446141 10:46347759-46347781 ATAATCCACCATGATCAAATGGG + Intergenic
1067503354 10:46826998-46827020 ATAATCCACCATGATCAAATGGG + Intergenic
1067591239 10:47513012-47513034 ATAATCCACCATGATCAAATGGG - Intronic
1067638357 10:48021104-48021126 ATAATCCACCATGATCAAATGGG - Intergenic
1067875136 10:49999254-49999276 ATAATCCACCATGATCAAATGGG + Intronic
1068924636 10:62523047-62523069 ATAATCCACCATGACCAAGTGGG - Intronic
1070134961 10:73685530-73685552 ATAATCCACCATGATCAAATGGG - Intronic
1071065084 10:81622436-81622458 ATCATTCATCATGACCAAATGGG - Intergenic
1071367831 10:84918180-84918202 ATAACCCATCATGACCAAGTAGG + Intergenic
1071947686 10:90665789-90665811 AAAAGGCATCACGACCAAATAGG + Intergenic
1074196546 10:111192107-111192129 ATAATACATCATGACCAAGTTGG - Intergenic
1074925393 10:118064008-118064030 ATAAACTATCAAGAACAAATAGG + Intergenic
1075432181 10:122395374-122395396 ATTAGCCATTAGTACCAACTTGG + Intronic
1076436297 10:130445393-130445415 ATAATATATCATGACCAAATGGG - Intergenic
1078481544 11:11680670-11680692 ATAAAACATCACGACCAAATAGG + Intergenic
1079590226 11:22174620-22174642 ATAAGCCATAAGTAACCAATTGG + Intergenic
1079740578 11:24054612-24054634 ATTAGCCATTAGGACAACATTGG - Intergenic
1080601488 11:33824962-33824984 ATAATTCATCATGGCCAAATGGG - Intergenic
1081544671 11:44062096-44062118 ACAATGCATCATGACCAAATGGG - Intergenic
1085547812 11:77336560-77336582 ATGAGCAATCAAGACCAAAATGG - Intronic
1086207599 11:84278622-84278644 ATAATGCATCATGACCAAGTAGG + Intronic
1086676124 11:89609336-89609358 ATAATTCATCATGACCAAGTGGG + Intergenic
1087358836 11:97131419-97131441 ATATTTCATCATGACCAAATGGG - Intergenic
1087690224 11:101312401-101312423 ATAACCCATCATGATCAAGTGGG - Intergenic
1087823629 11:102740044-102740066 ATAATTCATCATGACCAAATGGG - Intergenic
1087942608 11:104117023-104117045 ATAATCCATGAGGATCAAGTAGG + Intronic
1088166782 11:106948329-106948351 ATAAATCATCATGACCAAGTAGG + Intronic
1089538451 11:119174853-119174875 ATAGGCCATCAGGGACAAATTGG - Exonic
1090111517 11:123915186-123915208 ATTATCCATCATGACCAAGTGGG + Intergenic
1090254725 11:125275453-125275475 ATAAGCCATGAGGACTATAACGG + Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092642742 12:10534617-10534639 ATTAGCCATCATGACCAAGTGGG + Intergenic
1093538529 12:20252180-20252202 ATAATTCATCATGACCAAGTGGG + Intergenic
1093620418 12:21282225-21282247 ATCATTCATCATGACCAAATGGG + Intronic
1093964053 12:25306844-25306866 ATAATCCACCATGATCAAATGGG + Intergenic
1094030207 12:26003303-26003325 ATAATCCATTATGATCAAATGGG - Intronic
1094186268 12:27646264-27646286 ATAAGCCATCTGTACACAATAGG + Intronic
1094359509 12:29615094-29615116 ATAAGCGAACAGGGCCAATTTGG + Intronic
1094440877 12:30475142-30475164 ATCACTCATCATGACCAAATGGG + Intergenic
1095134119 12:38577519-38577541 ATCATCCTTCATGACCAAATGGG + Intergenic
1095500736 12:42835800-42835822 ATAATCCACCATGACCAAGTGGG - Intergenic
1097563247 12:61234988-61235010 ATAATTTATCATGACCAAATGGG - Intergenic
1097770284 12:63576085-63576107 ATTATTCATCATGACCAAATAGG + Intronic
1097965585 12:65576415-65576437 ATAATACATCCTGACCAAATAGG + Intergenic
1098667133 12:73178688-73178710 ATCATTCATCATGACCAAATGGG - Intergenic
1099494595 12:83330993-83331015 AGAAACTATAAGGACCAAATTGG - Intergenic
1099945760 12:89242460-89242482 ATATTTCATCATGACCAAATGGG - Intergenic
1100090696 12:90966483-90966505 ATTACACATCACGACCAAATGGG - Intronic
1100143957 12:91654408-91654430 ATAAGCCACCACGCCCAACTGGG - Intergenic
1103823782 12:123719796-123719818 ATAAACCATCCGGACCACACAGG + Intronic
1104197860 12:126558391-126558413 ACAAGCCATCAGGGACAGATGGG - Intergenic
1105295876 13:19087654-19087676 ACAAGCCCTCAGCACCAAAGCGG + Intergenic
1105463176 13:20610774-20610796 ATTATGCATCTGGACCAAATGGG + Intronic
1105558533 13:21468549-21468571 ATCATCCATCATGACCAAGTAGG - Intergenic
1106075132 13:26453076-26453098 ATCATTCATCATGACCAAATGGG + Intergenic
1106962715 13:35019098-35019120 AAAAGACATCATGACCAAGTTGG - Intronic
1106963740 13:35034358-35034380 ATCACCCATCATGATCAAATGGG - Intronic
1107287423 13:38810666-38810688 ATTATTCATCATGACCAAATAGG - Intronic
1108522904 13:51261097-51261119 ATCAGACATCAGGTGCAAATGGG - Intronic
1109475938 13:62880358-62880380 ATAATTCATCATGACCAAGTAGG + Intergenic
1109671153 13:65610204-65610226 ATGAGCCGAGAGGACCAAATAGG - Intergenic
1110204764 13:72899415-72899437 ATAATCCATCACGACCAAGTAGG + Intronic
1110481913 13:75988350-75988372 GTAATCCATCATGATCAAATAGG + Intergenic
1110501764 13:76236743-76236765 CTAAGCCAAAAGGACAAAATTGG + Intergenic
1111988733 13:95093333-95093355 ATAAGCCACCATGATCAAGTGGG + Intronic
1112256495 13:97837460-97837482 ATAATTCATCATGACCAACTGGG - Intergenic
1112945630 13:104923442-104923464 ATAATCCACCAGGATCAAGTGGG + Intergenic
1112985857 13:105448895-105448917 ATAACCCATGAGGACTAAGTTGG - Intergenic
1113141214 13:107152141-107152163 ATTAGCCATCAGGACCAAGTGGG - Intergenic
1113240606 13:108332614-108332636 ATAATCCACCATGATCAAATGGG + Intergenic
1113637842 13:111933188-111933210 ATAATCCATCATGATCAAGTGGG - Intergenic
1113845269 13:113384866-113384888 TTAATCCATCATGATCAAATGGG - Intergenic
1114915546 14:27260008-27260030 ATCAGACAACATGACCAAATGGG + Intergenic
1116062849 14:39945971-39945993 ATAATTCATCATGACCAAGTGGG - Intergenic
1116155016 14:41192993-41193015 ATCATTCATCATGACCAAATGGG + Intergenic
1116472521 14:45302550-45302572 ATAATCCACCATGATCAAATGGG - Intergenic
1116668756 14:47814007-47814029 ATAAGCCACCACGATCAAGTGGG - Intergenic
1116781570 14:49242862-49242884 ATAACATACCAGGACCAAATGGG - Intergenic
1118369243 14:65123017-65123039 ATAATACATCATGACCAAGTAGG - Intergenic
1119096522 14:71837765-71837787 ATGATACATCAAGACCAAATAGG - Intergenic
1119148742 14:72339251-72339273 ATAAGCCAGCAGAGCCAAACAGG - Intronic
1120118394 14:80648050-80648072 ATAATTCATCAGGACCAAAGGGG - Intronic
1120276113 14:82374892-82374914 ATCACTCATCATGACCAAATGGG + Intergenic
1120689256 14:87574576-87574598 AGGAGCCATCAGAACAAAATTGG + Intergenic
1120776411 14:88442638-88442660 ATAATCCATCACGATCAAGTGGG - Intronic
1122086098 14:99306256-99306278 ATAATACATCATAACCAAATAGG + Intergenic
1122654660 14:103249868-103249890 ATAAGCCCACATGACCAAAGAGG - Intergenic
1123214496 14:106793903-106793925 ATAATACATCATGACCAATTGGG - Intergenic
1124386441 15:29211827-29211849 ATAATCCACCATGACCAAGTGGG - Intronic
1124806832 15:32892407-32892429 ATAATCCACCAGGATCAAGTGGG - Intronic
1125178128 15:36849231-36849253 ATATGCCCTGAGGACCAAAATGG + Intergenic
1125273147 15:37962387-37962409 ATAATCCATCATGATCAAGTGGG - Intronic
1126040155 15:44582659-44582681 ATAACGCACCAGGCCCAAATTGG + Intronic
1126236122 15:46386576-46386598 ATAAGGTTTCAGGACCAAAGAGG + Intergenic
1127525097 15:59784882-59784904 ATAACCCATCATGACCAACTGGG + Intergenic
1128900633 15:71418606-71418628 ATCATTCATCAGGACCAAGTGGG - Intronic
1129058943 15:72844966-72844988 ATAATACATCATGATCAAATCGG + Intergenic
1130543118 15:84836177-84836199 GCAAGCCAGCAGGACCACATGGG + Intronic
1131326542 15:91452883-91452905 ATAATCCACCATGACCAAGTGGG - Intergenic
1132174262 15:99696943-99696965 ATAATACATCAAGACCAAGTTGG + Intronic
1134809436 16:17154711-17154733 AGAAACAATCAGGACCAATTTGG + Intronic
1140015656 16:71180679-71180701 ATAACACATCATGACCAAGTTGG + Intronic
1140543047 16:75777487-75777509 ATCATTCATCATGACCAAATGGG + Intergenic
1140548015 16:75830521-75830543 ATAATCCATCATGATCAAATGGG - Intergenic
1141504545 16:84466473-84466495 ATAAGACACCAGGACGAAGTGGG + Intergenic
1142277273 16:89127066-89127088 ATGACCCACCAGGACCAAGTGGG - Intronic
1144616418 17:16778895-16778917 ATAATCCATCATGATCAAGTGGG + Intronic
1144896279 17:18536758-18536780 ATAATCCATCATGATCAAGTGGG - Intergenic
1145135935 17:20407456-20407478 ATAATCCATCATGATCAAGTGGG + Intergenic
1146368687 17:32250220-32250242 ATAATACATCGTGACCAAATGGG - Intronic
1146462216 17:33055223-33055245 TGCAGCCATCAGGGCCAAATCGG - Intronic
1146490876 17:33280974-33280996 ATATGCCATCAGAATCAGATGGG + Intronic
1146745648 17:35326508-35326530 ATAATCCACCATGACCAAGTGGG - Intergenic
1149117689 17:53117704-53117726 ATAATCCACCATGACCAAGTGGG - Intergenic
1149180366 17:53929282-53929304 ATAATTCATCATGACCAAGTGGG - Intergenic
1149240768 17:54646077-54646099 ATAATTCATCATGACCAATTAGG + Intergenic
1149255259 17:54818845-54818867 ATAATACATCATGACAAAATTGG + Intergenic
1149897796 17:60443117-60443139 AAAAGCAATCAAAACCAAATTGG + Intergenic
1153016855 18:590707-590729 ATTATACATCATGACCAAATGGG - Intergenic
1153065769 18:1043155-1043177 ATAATCCACCATGATCAAATGGG + Intergenic
1153309347 18:3662920-3662942 ATAAGACAACAGCATCAAATGGG + Intronic
1153437958 18:5087219-5087241 CTAAGCCATTGGGACCAATTTGG + Intergenic
1154175359 18:12084174-12084196 ATAATTCATCATGACCAAGTGGG - Intergenic
1154345135 18:13536972-13536994 ATAATACATCATGGCCAAATGGG - Intronic
1154416095 18:14176639-14176661 ATAATTCATCAGGATCAAGTGGG + Intergenic
1155443794 18:25889228-25889250 ATCATCCATCATGACCAAGTGGG + Intergenic
1155467061 18:26148307-26148329 ATAATACATCATGACCAATTTGG + Intronic
1155767777 18:29656972-29656994 ATAATTCATCATGGCCAAATGGG + Intergenic
1156794036 18:41018803-41018825 ATAAGCCATCAGAATAGAATAGG + Intergenic
1157035859 18:43972560-43972582 ATAATACATCATGACCAAGTAGG + Intergenic
1157345762 18:46830958-46830980 ATAACAAATCATGACCAAATGGG + Intronic
1157798345 18:50597175-50597197 AGAAGCCTTCTGGACCAGATTGG + Intronic
1158002081 18:52631054-52631076 ATCAGCCATCAGCACCTATTCGG + Intronic
1158756818 18:60335217-60335239 ATAATCCACCATGATCAAATGGG + Intergenic
1165555984 19:36632579-36632601 AAAAGCCATCATAAACAAATTGG + Intergenic
1166603928 19:44123341-44123363 ATAATCCATCATGATCAAATGGG - Intronic
1168571145 19:57471385-57471407 CTAATACATCATGACCAAATGGG + Exonic
925325330 2:3015864-3015886 ATAATCCACCATGACCAAGTGGG + Intergenic
926478011 2:13352242-13352264 CTAACCCCTGAGGACCAAATAGG - Intergenic
926845412 2:17131921-17131943 ATAATGTATCATGACCAAATAGG + Intergenic
927168911 2:20351699-20351721 ACAAACCATCAAGAACAAATCGG - Intronic
927228422 2:20794539-20794561 ATAATACATCATGACCAAGTGGG + Intronic
927267434 2:21167021-21167043 ATAAGCCAGAAGAACTAAATAGG - Intergenic
927367306 2:22313739-22313761 ATAATATATCATGACCAAATTGG - Intergenic
928165907 2:28971666-28971688 AAAAGCCATCAGAACGAAAAAGG - Intronic
928254430 2:29709817-29709839 ATGAACCATCAGTACCTAATAGG - Intronic
929012920 2:37464127-37464149 ATAATACATCATGACCAAATGGG - Intergenic
929741870 2:44611086-44611108 ATATGCCTTCAGGAACATATTGG - Intronic
929991372 2:46791795-46791817 ATAATACATCATGACCAAATGGG + Intergenic
930423366 2:51181267-51181289 ATAATCCACCATAACCAAATGGG + Intergenic
930660982 2:54053065-54053087 ACAAGCCATCAGGACCAGGGAGG - Intronic
930764848 2:55074720-55074742 ATAATCCACCATGATCAAATGGG + Intronic
931171840 2:59811869-59811891 CTAAGCCATAAAGAACAAATTGG + Intergenic
933704327 2:85278455-85278477 ACAAACCACCATGACCAAATAGG + Intronic
933785242 2:85835005-85835027 ATAATTCATCATGATCAAATAGG + Intergenic
933883210 2:86692548-86692570 ATAATGCATCATGACCAAAGTGG + Intronic
935002988 2:99039912-99039934 ATAATACATCATGATCAAATGGG + Intronic
935356264 2:102203226-102203248 ATCATTCATCATGACCAAATGGG - Intronic
935376122 2:102399569-102399591 ATAAGCCATTAAAAACAAATAGG + Intergenic
935836435 2:107060323-107060345 ATAATCCACCACGATCAAATGGG - Intergenic
936994747 2:118401539-118401561 ATCATTCATCATGACCAAATGGG - Intergenic
937194355 2:120137995-120138017 ATAAGTCATCACGTCCAAGTGGG + Intronic
938773568 2:134521630-134521652 CAAAGCCAACAGAACCAAATTGG + Intronic
940395676 2:153187877-153187899 ATAAGTCATCATTACCAAGTAGG + Intergenic
940618375 2:156080461-156080483 ATAATCCACCATGATCAAATGGG - Intergenic
940844463 2:158624873-158624895 ATCAGCCATCAGTAGCCAATCGG + Exonic
940933992 2:159470083-159470105 ATAACCCATCATAACCAAGTGGG + Intronic
941302667 2:163823525-163823547 ATCATTCATCAGGACCAAGTGGG - Intergenic
941310489 2:163923760-163923782 ATAATACATCATGACCAAGTGGG - Intergenic
941540362 2:166774797-166774819 ATAATCCATCATGGCCAAGTAGG - Intergenic
942829046 2:180216923-180216945 CTAATCCATCATGACCAAGTAGG + Intergenic
943167752 2:184351993-184352015 ATAAGCTACCAGGATCAAGTGGG + Intergenic
943714781 2:191138895-191138917 ATAATACATCATGATCAAATGGG + Intronic
944475496 2:200100222-200100244 ATAATACTTCATGACCAAATTGG - Intergenic
945713771 2:213332666-213332688 ATAATTCATCATGACCAAGTGGG + Intronic
945761248 2:213918118-213918140 CTAATCCATCATGACCAAGTAGG - Intronic
946054133 2:216886181-216886203 TGAAGCCATCAAGACCAATTGGG + Intergenic
946204979 2:218098531-218098553 ATAATACATCATGATCAAATGGG - Intergenic
946570895 2:221023028-221023050 ATAATCCATCATGATCAAGTGGG - Intergenic
946855568 2:223946357-223946379 AAAAACCACCAGGAACAAATGGG - Intergenic
947958923 2:234218330-234218352 ATCACCCATGTGGACCAAATGGG - Intergenic
948791620 2:240381221-240381243 ATAAAACATCACAACCAAATTGG + Intergenic
1169286121 20:4308678-4308700 AGAAGCAATCAGGACCAAACTGG - Intergenic
1169380516 20:5102921-5102943 ATCATTCATCAGGACCAAGTGGG + Intronic
1169571272 20:6908736-6908758 ACTAGACATCAGGACCAGATTGG + Intergenic
1169921126 20:10735370-10735392 ATCAGCCTTCAGAACCAAACAGG + Intergenic
1170218228 20:13914888-13914910 AGAAGCCATCTGGACCTGATTGG + Intronic
1171028847 20:21657702-21657724 ATAATCCATCATGATCAAGTGGG + Intergenic
1174981811 20:55404390-55404412 ATTAGTCATCATGACCAACTGGG - Intergenic
1176857248 21:13982656-13982678 ATAATTCATCAGGATCAAGTAGG - Intergenic
1176867361 21:14061574-14061596 ATAATTCATCAGGATCAAGTGGG + Intergenic
1177174137 21:17685905-17685927 ATAATCCATCATGAGCAAGTGGG - Intergenic
1178038518 21:28612223-28612245 ATAATCCACCATGATCAAATGGG + Intergenic
1178957376 21:37035483-37035505 ATAAGCCATCATGCCCAACCTGG + Intergenic
1180114406 21:45689242-45689264 ATAAGCCATCAGGACCAAATGGG + Intronic
1180251059 21:46589099-46589121 ATAATCCACCATGATCAAATGGG + Intergenic
1181297344 22:21850823-21850845 ATAATACATCATGACCAAGTTGG + Intronic
1181790922 22:25265716-25265738 ATAAGTCATGAGGCTCAAATGGG + Intergenic
1183609935 22:38893686-38893708 ATAATACATCATGACCAAATTGG + Intergenic
1183755541 22:39758957-39758979 ATAATACATCATGACCAAGTGGG - Intronic
1183761947 22:39829454-39829476 AAAAGCCATCAGCAGAAAATAGG + Intronic
1185293237 22:50039004-50039026 ATAATACATCAGAACCAAATGGG - Intronic
950204093 3:11064696-11064718 ATAAGCCATCATGACAAATGAGG - Intergenic
951153431 3:19320527-19320549 ATAATCCACCATGACCAAGTGGG - Intronic
951171733 3:19550157-19550179 ATCATTCATCATGACCAAATGGG - Intergenic
952024239 3:29059129-29059151 ATAATCCATTATGATCAAATAGG + Intergenic
952732806 3:36656971-36656993 ATAATCCATCATGATCAACTGGG + Intergenic
952811342 3:37406492-37406514 ATCATTCATCATGACCAAATAGG - Intronic
953185587 3:40635091-40635113 ATAACCCACCATGATCAAATGGG + Intergenic
953353692 3:42235472-42235494 ATCACTCATCATGACCAAATGGG + Intergenic
954502002 3:51026327-51026349 ATAATTCATCATGATCAAATGGG - Intronic
956082518 3:65573344-65573366 ATAATACATCATGAGCAAATAGG + Intronic
957037307 3:75306297-75306319 ATAATACATCATGACCAAGTGGG - Intergenic
957134102 3:76263017-76263039 ACATGCCATCAGTACCAGATAGG + Intronic
957606887 3:82411292-82411314 GTAAGCCATCAGGATAACATTGG + Intergenic
958010566 3:87873719-87873741 ATTATACATCATGACCAAATGGG + Intergenic
958064263 3:88522686-88522708 ATAAGCCACCATGATCAAGTGGG - Intergenic
958617862 3:96518871-96518893 ATCATCCATCATGACCAAGTGGG + Intergenic
959118169 3:102202094-102202116 ATCATCCATCATGACCAAGTGGG - Intronic
959998388 3:112703532-112703554 ATAATCCACCATGACCAAGTGGG + Intergenic
962193913 3:133340715-133340737 ATCATTCATCATGACCAAATGGG + Intronic
962742856 3:138375233-138375255 ATAATACATCATGACCAAGTGGG - Intronic
962823179 3:139072718-139072740 ATAATGCACCATGACCAAATGGG + Intronic
962999691 3:140667507-140667529 ATAATCCACCATGATCAAATGGG + Intergenic
963618146 3:147570088-147570110 ACAATTCATCATGACCAAATAGG - Intergenic
964075954 3:152692095-152692117 ATAATCCACCATGATCAAATGGG + Intergenic
965009418 3:163066781-163066803 CTAATCCATCATGATCAAATAGG + Intergenic
965254741 3:166391555-166391577 ATAATCCATCATGATCAAGTGGG - Intergenic
965607722 3:170513044-170513066 ACAATCCATCAGGACCACGTAGG - Intronic
965718726 3:171637122-171637144 ATTATACATCATGACCAAATGGG - Intronic
966050920 3:175617343-175617365 ATGGTCCAGCAGGACCAAATGGG - Intronic
966531951 3:180990807-180990829 ATAAGACCTTGGGACCAAATTGG + Intergenic
966547176 3:181162610-181162632 ATCAGGCACCATGACCAAATAGG - Intergenic
967655848 3:192047502-192047524 ATAATTCATCATGACCAAGTGGG + Intergenic
967738264 3:192976993-192977015 ATCAGTCATCAAGACCAAGTGGG + Intergenic
968018224 3:195358388-195358410 ATAAGGCACCAGGGGCAAATCGG + Intronic
970737007 4:19183190-19183212 ATAAAATATCAGGAACAAATTGG - Intergenic
971427225 4:26528444-26528466 ATAAGGCATAATGACCAAATAGG + Intergenic
971567498 4:28164126-28164148 ATAATACATCATGACCAAGTGGG - Intergenic
972806768 4:42536735-42536757 ATAATCCACCAGGATCAAGTGGG + Intronic
972899516 4:43665877-43665899 ATAATCCATCATGATCAAGTGGG - Intergenic
972909952 4:43802388-43802410 ATCATTCATCAGGACCTAATGGG + Intergenic
973700141 4:53529051-53529073 ATAAGCCAGCAAGACCAGAATGG - Intronic
974410487 4:61535289-61535311 ATAATCCATCACGATCAAATGGG - Intronic
974634115 4:64536833-64536855 ATAAGCCACCATGACCAGTTTGG + Intergenic
975209488 4:71682651-71682673 ATAAGATATCAGGACCAAGTAGG - Intergenic
975343710 4:73270216-73270238 ATAATACATCATGACCAAGTGGG - Intergenic
975463230 4:74679254-74679276 ATAATTCATCAGGACCAACTGGG - Intergenic
976593854 4:86875831-86875853 ATAAGCCACCATGACCAGCTTGG + Intergenic
976762421 4:88564138-88564160 ATAATTCATTAAGACCAAATAGG - Intronic
977185884 4:93935488-93935510 ATAATTCATCACGACCAAGTGGG + Intergenic
977833254 4:101617990-101618012 ATATGCAATCAGGCTCAAATAGG - Intronic
978441182 4:108735591-108735613 ATAATGCATCATGACCAAGTGGG + Intergenic
978917260 4:114142389-114142411 ATAATCCATCATCATCAAATGGG - Intergenic
979280549 4:118862676-118862698 ATCATTCATCATGACCAAATGGG - Intronic
980084994 4:128381826-128381848 ATAATCCATGAGGGGCAAATTGG - Intergenic
980210146 4:129776753-129776775 ATAAGAAATCAGGACTAATTTGG + Intergenic
980580355 4:134742491-134742513 ATAAGCCACCATGATCAAGTGGG + Intergenic
980846218 4:138328634-138328656 ATAATGCATCAGGACCAACCAGG - Intergenic
981886943 4:149687741-149687763 ATAAGCCACCATGATCAAGTGGG + Intergenic
982865390 4:160504340-160504362 ATGAGCCACCTTGACCAAATTGG - Intergenic
983036146 4:162868431-162868453 ATAATCCACCATGACCAAGTGGG + Intergenic
983749612 4:171249726-171249748 ATAATCCACCATGATCAAATGGG - Intergenic
985911130 5:2884159-2884181 ATAAGCCATCAGGGCCAGCTAGG + Intergenic
986394813 5:7318066-7318088 ATAAGGCATCAGGAGTAAAGGGG - Intergenic
986870537 5:12040118-12040140 ATAATCCACCATGATCAAATGGG + Intergenic
987164777 5:15186047-15186069 ATAATTCATCATGACCAACTGGG + Intergenic
989129193 5:38088165-38088187 ATAAAACATCATGACCAAGTAGG + Intergenic
989533493 5:42536513-42536535 ATAATCCACCATGACCAAGTGGG - Intronic
989608288 5:43266800-43266822 ATAATACATCATGATCAAATGGG - Intronic
989806095 5:45607430-45607452 ATAAGACATCAAGACCAAGTTGG + Intronic
990940020 5:61192704-61192726 AAAGGCCAACAGGACAAAATTGG - Intergenic
991496472 5:67231191-67231213 ATAATACCTCATGACCAAATGGG - Intergenic
991664008 5:68978898-68978920 ATCATCCAACATGACCAAATGGG + Intergenic
991922866 5:71674679-71674701 ATCACTCATCATGACCAAATAGG - Intergenic
991924186 5:71687709-71687731 ATAATCCATCATGATCAAGTGGG + Intergenic
991936740 5:71809645-71809667 ATGAGTCAGCAGGCCCAAATGGG + Intergenic
992339777 5:75811182-75811204 ATAATCCATCATGATCAAGTGGG - Intergenic
992520648 5:77546914-77546936 ATAATCCACCATGATCAAATGGG + Intronic
993633354 5:90314710-90314732 ATAACACATCATAACCAAATGGG - Intergenic
994654342 5:102571405-102571427 ATCATCCATCATGACCAAGTGGG + Intergenic
995347725 5:111139832-111139854 ATAATGCGTCATGACCAAATGGG + Intergenic
995380589 5:111528645-111528667 ATAATACATCATGACCAAGTCGG + Intergenic
995699715 5:114920987-114921009 ATAATCCATCATGATCAAGTGGG + Intergenic
995763727 5:115592787-115592809 ATAATCCATCACAACCAAGTTGG + Intronic
996136496 5:119848701-119848723 ATAATACATCATGATCAAATGGG + Intergenic
996655679 5:125932726-125932748 ATAGTCCATCATGACAAAATGGG + Intergenic
997044963 5:130304755-130304777 ATAATACATCATGACCAAATGGG - Intergenic
997971748 5:138408713-138408735 ATAATACATCATGAACAAATGGG + Intronic
998544556 5:143015609-143015631 GGAAGCCATCAGGACCAGAGGGG + Intronic
998603444 5:143608538-143608560 ATAATCCAACATGATCAAATGGG + Intergenic
998703086 5:144727645-144727667 ATAAGACATCATGATCAAGTGGG - Intergenic
999350771 5:150869328-150869350 ATAATCCACCATGATCAAATGGG - Intronic
1000392340 5:160737049-160737071 ATAATACATCATGACCAAGTGGG + Intronic
1000409350 5:160921844-160921866 ATAAGTCATGAGGCCCAAAAGGG - Intergenic
1000688585 5:164285537-164285559 ATAATCCACCATGACCAAGTGGG - Intergenic
1000861873 5:166465549-166465571 ATAAGCCACCATGATCAACTGGG - Intergenic
1001733411 5:173977856-173977878 ATAATCCATCATGATCAAGTGGG - Intronic
1003361660 6:5432604-5432626 ATAAGCAGTGAGCACCAAATTGG + Intronic
1003561196 6:7182042-7182064 CGAAGCCTCCAGGACCAAATCGG + Exonic
1004052116 6:12094639-12094661 ATTAAACATCATGACCAAATTGG - Intronic
1004777863 6:18868926-18868948 ATAATCCACCATGATCAAATAGG + Intergenic
1005007498 6:21303145-21303167 ATAATACATCATGACCAAATGGG + Intergenic
1005036971 6:21564813-21564835 ATCATTCATCATGACCAAATGGG - Intergenic
1006064258 6:31451342-31451364 ATAACACATAATGACCAAATGGG + Intergenic
1006978936 6:38130661-38130683 ATAATCCACCATGATCAAATGGG - Intronic
1008305622 6:49895694-49895716 ATAATCCACCATGATCAAATGGG + Intergenic
1008640700 6:53459433-53459455 ATAATTCATCATGACCAAGTGGG + Intergenic
1008668328 6:53740288-53740310 ATAATGCATCATGACCAAAGTGG + Intergenic
1008775098 6:55028717-55028739 ATAATCCATCATGATCAAGTGGG - Intergenic
1009352828 6:62703852-62703874 ATCATTCATCAGGACCAAGTGGG - Intergenic
1009371580 6:62910162-62910184 ATAATTCATCATGACCAAGTAGG + Intergenic
1009875734 6:69502838-69502860 ATAAAAGTTCAGGACCAAATTGG + Intergenic
1010045613 6:71439682-71439704 ATAATCCATCATGATCAAGTAGG + Intergenic
1010164787 6:72902690-72902712 ATAATCCACCATGATCAAATGGG - Intronic
1010181588 6:73092760-73092782 ATAATCCACCATGATCAAATGGG - Intronic
1010501158 6:76601830-76601852 ATTATCCATCAGGATCAAGTCGG + Intergenic
1010951925 6:82047364-82047386 AGAAGCCATGAAGCCCAAATCGG + Intergenic
1010995427 6:82526476-82526498 CAGAGCCATCAGAACCAAATTGG + Intergenic
1011094970 6:83650877-83650899 AAAAACCATCAGGCCCACATGGG - Intronic
1011102582 6:83739939-83739961 ATTAGTCATCATGACCAAGTGGG - Intergenic
1012192025 6:96291745-96291767 ATTATACATCAGGACCAAGTGGG + Intergenic
1012208082 6:96486103-96486125 ATAATCCACCATGATCAAATAGG - Intergenic
1014285354 6:119490959-119490981 ATAAGCCACCATGATCAAGTGGG + Intergenic
1014331442 6:120070340-120070362 ATCATTCATCACGACCAAATTGG - Intergenic
1014834150 6:126140226-126140248 ATTACACATCAGGACCAAATAGG - Intergenic
1016197142 6:141358159-141358181 ATAATCCACCATGACCAACTGGG - Intergenic
1016457089 6:144242662-144242684 ATCATTCATCATGACCAAATAGG - Intergenic
1017397838 6:154023889-154023911 ATAATTCATCATGACCAAGTGGG - Intronic
1018138162 6:160798945-160798967 ATTTTCCATCAGGACAAAATTGG + Intergenic
1018285962 6:162237978-162238000 AGAAGCCATGAGGAAGAAATAGG + Intronic
1018656152 6:166038360-166038382 ATAATCCACCATGATCAAATGGG - Intergenic
1020374706 7:7471511-7471533 ATAATCCACCATGATCAAATGGG + Intronic
1021681193 7:23134299-23134321 ATAATTCATCATGACCAAGTGGG - Intronic
1022676682 7:32507006-32507028 ATAATACATCATAACCAAATGGG + Intronic
1023273002 7:38486719-38486741 ATCACCCATCATGACCAAGTAGG + Intronic
1023748616 7:43347868-43347890 ATAATCCACCATGATCAAATGGG - Intronic
1024327706 7:48123881-48123903 ATAATCCACCAGGATCAAGTGGG - Intergenic
1024480980 7:49862818-49862840 ATTATACATCATGACCAAATGGG - Intronic
1024916912 7:54511905-54511927 ATAATCCACCATGATCAAATGGG - Intergenic
1027334320 7:77132362-77132384 ATAATGCATCATGACCAAGTGGG + Intronic
1027462256 7:78469261-78469283 ATTAGCCATATGGAGCAAATGGG + Intronic
1028640184 7:93033562-93033584 ATAATCCATCATGATCAAGTAGG + Intergenic
1029220730 7:98988043-98988065 ATTATCCATCATGACCAAGTGGG - Intronic
1029502402 7:100940309-100940331 ATAATGCATCATGACCAAGTGGG - Intergenic
1029781529 7:102739236-102739258 ATAATACATCATGACCAAGTGGG - Intergenic
1029825653 7:103190766-103190788 ATTATTCATCATGACCAAATAGG + Intergenic
1030011762 7:105176117-105176139 ATAAAACATCATGATCAAATGGG + Intronic
1030407927 7:109138330-109138352 ATCATTCATCAGGACCAAGTGGG - Intergenic
1030435651 7:109516119-109516141 AAATGCCATCAGGAAAAAATTGG + Intergenic
1030966589 7:116000106-116000128 AAAATTCATCATGACCAAATGGG + Intronic
1031306602 7:120135210-120135232 ATAAGTCAACATGACCAAGTGGG + Intergenic
1031906072 7:127460964-127460986 ATCATTCATCATGACCAAATGGG + Intergenic
1032290348 7:130584102-130584124 ATAATCCACCATGACCAAGTGGG + Intronic
1032911997 7:136443170-136443192 ATAATCCATCATGATCAAGTGGG + Intergenic
1033961255 7:146916167-146916189 ATAATCCATCATGATCAAGTGGG - Intronic
1034403385 7:150882792-150882814 ATAATCCACCATGATCAAATGGG + Intergenic
1034748568 7:153546450-153546472 ATAATCCATCATGACCAAAAAGG + Intergenic
1036966960 8:13309867-13309889 CTAAGTCATCAGGAAGAAATTGG - Intronic
1036997398 8:13674582-13674604 ATATGCCAGCAGGGCCAAAGTGG - Intergenic
1037186515 8:16070121-16070143 ACAATACATCAGGACCAAGTGGG + Intergenic
1037445211 8:18958593-18958615 ATAATCTATCATGACCAACTTGG + Intronic
1039082983 8:33752002-33752024 ATAACCCATCATGATCAAGTGGG - Intergenic
1042160876 8:65893733-65893755 ATAATCCATCATGATCAAGTGGG + Intergenic
1042473977 8:69224085-69224107 ATAAGCCACCATGAACAATTTGG - Intergenic
1043395966 8:79836803-79836825 ATAATGCATCATGACCAAGTGGG + Intergenic
1043451592 8:80372934-80372956 ATAAGACATTATGACCAAGTAGG + Intergenic
1043832372 8:85004938-85004960 ATAATCCACCAGGATCAAATGGG + Intergenic
1043988188 8:86718812-86718834 ATAATCCACCATGATCAAATGGG + Intronic
1044227914 8:89740319-89740341 ATAATCCACCATGACCAAGTGGG + Intergenic
1045878225 8:107007782-107007804 ATAATCCATCATGATCAAGTGGG + Intergenic
1046113834 8:109761127-109761149 ATCATCCATCATGACCAAGTGGG - Intergenic
1047841014 8:128753125-128753147 ATAATACATCATGACCAACTGGG + Intergenic
1048193914 8:132316147-132316169 ATAAGCCATCGTGATTAAATGGG + Intronic
1050126828 9:2365511-2365533 ATAATGCATTAGGACCAAATTGG + Intergenic
1050904642 9:10988904-10988926 ATAATACATCATGAACAAATAGG + Intergenic
1054370687 9:64392740-64392762 ATAGGTCATCAGTAGCAAATAGG + Intronic
1054526030 9:66129756-66129778 ATAGGTCATCAGTAGCAAATAGG - Intronic
1054678318 9:67882488-67882510 ATAGGTCATCAGTAGCAAATAGG + Intronic
1055228106 9:74026011-74026033 ATAAGCAAACAGGCTCAAATAGG + Intergenic
1056287416 9:85104981-85105003 ATCAGCCAACAGGACTTAATTGG - Intergenic
1056517072 9:87363704-87363726 ATCATCCATCATGACCAAATGGG + Intergenic
1056948411 9:91021423-91021445 ATAATCCACCATGATCAAATGGG + Intergenic
1057532844 9:95869131-95869153 ATAATGCATCATGACCAAGTTGG - Intergenic
1058156413 9:101521067-101521089 ATAATCCACCATGATCAAATGGG - Intronic
1058308095 9:103468072-103468094 ATAATCCATCATGATCAAGTGGG - Intergenic
1058784281 9:108371101-108371123 ATAATCCACCATGACCAAGTGGG - Intergenic
1059734572 9:117088391-117088413 ATAAGCCATGAGTCCCAAAATGG - Intronic
1061533708 9:131234688-131234710 ATAAGCCATCAGAACCAAGGAGG - Intergenic
1186140615 X:6567992-6568014 GTGAGGCATCAGGACCACATGGG - Intergenic
1186308734 X:8293690-8293712 ATAATCCACCATGATCAAATGGG + Intergenic
1187610346 X:20936556-20936578 ATCATCCATCATGACCAAGTGGG - Intergenic
1188770184 X:34144477-34144499 ATAAGCCAACATGACCATATGGG - Intergenic
1188889874 X:35596556-35596578 ATAATCCACCATGACCAAGTGGG + Intergenic
1189875940 X:45436189-45436211 TTAAGCCAGCAAGAACAAATAGG + Intergenic
1189963397 X:46347235-46347257 ATTATACATCAAGACCAAATGGG + Intergenic
1190238274 X:48634245-48634267 ATCATACATCATGACCAAATGGG + Intergenic
1190456327 X:50631182-50631204 ATAATACATCATGACCAAGTGGG + Intronic
1190568504 X:51757055-51757077 ATAATGCATCAGGAACAAGTAGG + Intergenic
1190615043 X:52221882-52221904 ATCAGTCATCACGACCAACTGGG + Intergenic
1190634700 X:52422218-52422240 ATAAGCCATGATGCCCATATAGG - Intergenic
1191059069 X:56275843-56275865 ATAATTCATCATGTCCAAATGGG - Intronic
1191801255 X:65082898-65082920 ATCATTCATCATGACCAAATCGG + Intergenic
1191924150 X:66291193-66291215 ATCATTCATCATGACCAAATGGG - Intergenic
1192135463 X:68594899-68594921 ATCATTCATCATGACCAAATGGG + Intergenic
1192530457 X:71878548-71878570 ATCATTCATCATGACCAAATGGG + Intergenic
1192635941 X:72817748-72817770 ATAATTCATCATGACCAAATGGG - Intronic
1192645773 X:72903055-72903077 ATAATTCATCATGACCAAATGGG + Intronic
1192820549 X:74640477-74640499 ATAATCCACCATGATCAAATGGG + Intergenic
1193078257 X:77378626-77378648 ATAATCCACCATGATCAAATGGG + Intergenic
1193098712 X:77583128-77583150 ATCATCCATCATGACCAACTGGG + Intronic
1193421122 X:81283460-81283482 ATAATCCACCATGATCAAATGGG + Intronic
1193540943 X:82771782-82771804 ATAATCCACCATGATCAAATGGG - Intergenic
1193578813 X:83236200-83236222 ATAATCCACCATGATCAAATAGG + Intergenic
1194173295 X:90616122-90616144 ATCATTCATCATGACCAAATGGG - Intergenic
1194253516 X:91607476-91607498 ATCAGTCATCATGACCAAGTGGG + Intergenic
1194390216 X:93308724-93308746 ATCATTCATCATGACCAAATGGG + Intergenic
1195629524 X:107040370-107040392 ATTATACATCAAGACCAAATGGG + Intergenic
1195897043 X:109756559-109756581 ATCATTCATCAGGACCAAGTAGG + Intergenic
1196072374 X:111539802-111539824 AGAATACATCATGACCAAATGGG + Intergenic
1196217190 X:113067187-113067209 ATCATTCATCATGACCAAATGGG - Intergenic
1196507962 X:116471441-116471463 ATCACTCATCATGACCAAATAGG - Intergenic
1196578806 X:117354878-117354900 ATAATTCATCATGACCAAGTGGG - Intergenic
1196614102 X:117747914-117747936 ATTATTCATCATGACCAAATGGG + Intergenic
1196914463 X:120518081-120518103 ATTAGACAACATGACCAAATGGG + Intergenic
1197054563 X:122101140-122101162 ATAAGCCACCATGATCAAGTGGG + Intergenic
1197090526 X:122530989-122531011 ATCATCCATCATGACCAAGTGGG + Intergenic
1197810689 X:130440182-130440204 ATCAGTCATCATGACCAAGTGGG - Intergenic
1198658670 X:138942576-138942598 AAAAGCCATTAGGAAGAAATGGG + Intronic
1198817752 X:140610387-140610409 ATCATTCATCATGACCAAATGGG - Intergenic
1199040205 X:143105765-143105787 ATCATTCATCATGACCAAATAGG + Intergenic
1199249385 X:145641998-145642020 ATAAAGCATCATGACCAAGTGGG + Intergenic
1199348861 X:146775968-146775990 ATAATCCATCAGAATCAAGTGGG - Intergenic
1199581074 X:149361019-149361041 ATCATTAATCAGGACCAAATGGG - Intergenic
1199603135 X:149555092-149555114 ACAAACCATCCGGACCAAACGGG + Intergenic
1199647253 X:149924383-149924405 ACAAACCATCCGGACCAAACGGG - Intergenic
1199926634 X:152473660-152473682 ATAATCCACCATGACCAAGTGGG + Intergenic
1199941803 X:152635134-152635156 AGAAGCCATCAGGACAAAAGAGG + Intergenic
1200271220 X:154686265-154686287 ATAATACACCATGACCAAATGGG + Intronic
1200519515 Y:4193835-4193857 ATCATTCATCATGACCAAATGGG - Intergenic
1200572296 Y:4847057-4847079 ATCAGTCATCATGACCAAGTGGG + Intergenic
1201352818 Y:13064635-13064657 ATAACCCACCAGGATCAAATGGG + Intergenic