ID: 1180115099

View in Genome Browser
Species Human (GRCh38)
Location 21:45697988-45698010
Sequence TAGTGTGTAGGGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 463}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180115099_1180115108 12 Left 1180115099 21:45697988-45698010 CCATCCACCTTCCCTACACACTA 0: 1
1: 0
2: 1
3: 33
4: 463
Right 1180115108 21:45698023-45698045 CTTATCCTGTTGTCTCACCTGGG 0: 1
1: 0
2: 0
3: 14
4: 155
1180115099_1180115107 11 Left 1180115099 21:45697988-45698010 CCATCCACCTTCCCTACACACTA 0: 1
1: 0
2: 1
3: 33
4: 463
Right 1180115107 21:45698022-45698044 CCTTATCCTGTTGTCTCACCTGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180115099 Original CRISPR TAGTGTGTAGGGAAGGTGGA TGG (reversed) Intronic
901638143 1:10679898-10679920 TAATGGGTAGGGATGCTGGAAGG - Intronic
903265151 1:22153741-22153763 ATGTGTGTTGGGGAGGTGGATGG + Intergenic
904692232 1:32302047-32302069 TAGTGTGAATTGAAGGTAGAGGG + Intronic
905048050 1:35024140-35024162 CAATTTGTAGGTAAGGTGGAGGG - Intronic
906927715 1:50137044-50137066 TCGTATGTAGGTAAAGTGGAGGG + Intronic
907435443 1:54443096-54443118 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
908180212 1:61596496-61596518 CTGTGTGTAAGGGAGGTGGAGGG - Intergenic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908766478 1:67559118-67559140 TAGTGTCAAGGGAAGTTGGCTGG - Intergenic
910544175 1:88395521-88395543 TGGTGTGTGGGGAAGGCGGAAGG + Intergenic
911596887 1:99808043-99808065 TAGTGTGTGGGGCAGGGAGAAGG + Intergenic
911967319 1:104385066-104385088 TGATGTGTAGGGAAGGGGGGAGG - Intergenic
912581827 1:110727889-110727911 TTGGGTGTAGGAAAGATGGAAGG + Intergenic
912623462 1:111188824-111188846 AAGTGTGGAGTGAAGGTGGTTGG + Intronic
913169838 1:116222019-116222041 AAGTGAGGAGGGAAGGAGGAGGG + Intergenic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914863562 1:151406391-151406413 TAGTGGGGAAGGAAGGAGGAGGG + Exonic
916078630 1:161218175-161218197 AAGTTTGGAGGGAAGGGGGATGG + Intronic
916329153 1:163595282-163595304 TGATGTGTAGGGAAGGTGAGGGG - Intergenic
916821038 1:168399009-168399031 GAGTGGGATGGGAAGGTGGATGG + Intergenic
918429932 1:184449190-184449212 TAGGGTGGGGGGAAGGGGGAGGG - Intronic
918720147 1:187842101-187842123 TAGAGGGGAGGGAAGGAGGAGGG - Intergenic
918786066 1:188765535-188765557 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
919384744 1:196906993-196907015 TAGTGTGTGGTGAAGATGGCTGG + Exonic
919385254 1:196914627-196914649 TAGTGTGTGGTGAAGATGGGTGG + Exonic
920915686 1:210256263-210256285 TACGGTGTAGGGGAGGGGGAAGG - Intergenic
921298821 1:213729915-213729937 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
922640085 1:227221531-227221553 TAGTGGGAAGGGAGGGTGGGTGG - Intronic
922751140 1:228070550-228070572 TAGTGTATAGGGATAGTGTAGGG + Intergenic
922751272 1:228071161-228071183 TAGTGTAGAGGGATGGTGTAGGG + Intergenic
922854333 1:228761152-228761174 TTGTGGGTAGGGCAGGGGGAGGG + Intergenic
923729336 1:236535638-236535660 TTGTGTGTAGAGAATGGGGAAGG - Intronic
923747009 1:236710880-236710902 TGGGGGGTAGGGAAGGGGGATGG - Intronic
923796159 1:237157736-237157758 TAGTGGGAAGGGACGGTGGGAGG + Intronic
924032082 1:239895818-239895840 GAGTGTGGAGGGTGGGTGGAGGG + Intronic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1062876041 10:943732-943754 TGGAGTGGAGGGAAGGTGCAGGG + Intergenic
1063111010 10:3037441-3037463 TGGGGTGCAGGGCAGGTGGATGG + Intergenic
1063324179 10:5080682-5080704 TAGTGTTTAGGAAGGATGGAAGG + Intronic
1063368146 10:5503946-5503968 TGGTGTGTAGGGGAGGTGTGTGG - Intergenic
1063368156 10:5503986-5504008 TGGTGTGTAGGGGAGGTGCGCGG - Intergenic
1063368161 10:5504006-5504028 TGGTGTGTAGGGGAGGTGTGTGG - Intergenic
1063368183 10:5504094-5504116 TGGTGTGTAGGGGAGGTGCGTGG - Intergenic
1063368188 10:5504114-5504136 TGGTGTGTAGGGGAGGTGCGTGG - Intergenic
1063368193 10:5504134-5504156 TGGTGTGTAGGGAAGGTGTGTGG - Intergenic
1064301715 10:14128837-14128859 GAGAGTGTAGGGCAGATGGAAGG - Intronic
1067735215 10:48845318-48845340 GAGTGTGTGGGGGAGGTTGAAGG - Intronic
1068058061 10:52035309-52035331 TGGTGTGTAGGGAAGGAAGGGGG + Intronic
1068179333 10:53500368-53500390 TGGTGTGTAGGGAAGGGAGGGGG + Intergenic
1068224738 10:54092448-54092470 TAGTGTGTATGGCATGGGGAGGG - Intronic
1069725197 10:70573060-70573082 TATTTTGTAGGGTAAGTGGAAGG + Intergenic
1070016448 10:72537271-72537293 TGGAGTGTGGGGAATGTGGATGG + Intronic
1070893819 10:79964731-79964753 TAATGTGTAGGGAAGGGAGCGGG - Intronic
1070953376 10:80448555-80448577 GAGTGGGAAGGGAAGGTGGGAGG - Intergenic
1071458636 10:85870636-85870658 TGCTGTGGAAGGAAGGTGGAGGG + Intronic
1071586818 10:86831200-86831222 TCGTGTATAAGGAAGGTGCAGGG - Intronic
1071822102 10:89289389-89289411 TAGTGTGTAAGGAAGGGAGGGGG - Intronic
1072968482 10:99995501-99995523 TAGTGTATATGGTAGGTAGAAGG - Intronic
1075701018 10:124469477-124469499 TGGTGTGAAGGGAAGGTGGGTGG - Intronic
1077366351 11:2162846-2162868 GAGTGTGTAGGGAGGGAGGCTGG + Intergenic
1077615821 11:3672818-3672840 TTGTGTGTTAGGAAGGTGGTTGG - Intronic
1078754001 11:14191443-14191465 AAGTGTGTGGGGAAGGAAGAAGG - Intronic
1078828065 11:14950813-14950835 TATTCTGTAGGGATGGTGGCAGG - Intronic
1079188088 11:18254976-18254998 GAGTGATTAGGGCAGGTGGATGG - Intergenic
1079631583 11:22684162-22684184 TAGGGTGTAGGGATGTTAGATGG + Intronic
1080203915 11:29706918-29706940 GTATGTGTAGGGAAGGTGGGGGG + Intergenic
1080697924 11:34619316-34619338 TTGTGTGTAGTGATGGTGAAGGG - Intergenic
1081172639 11:39887775-39887797 TATTTTGTAGGGGAGGGGGAGGG + Intergenic
1081493390 11:43583521-43583543 TATTGTGAAGGGAAGGGGGAAGG - Intronic
1081655824 11:44856833-44856855 AAGTGTGTAGGGAGGGAGGGAGG - Intronic
1081991781 11:47341966-47341988 GAGTGTGCAGGGCAGGTGGATGG - Intronic
1082314515 11:50700445-50700467 TGGTGTGAGGGGAAGGGGGAGGG + Intergenic
1082801929 11:57421243-57421265 CAGGGTGGCGGGAAGGTGGAGGG - Intronic
1083316003 11:61815493-61815515 TAGTGGATAGGGACAGTGGAGGG + Intronic
1083796855 11:65021891-65021913 TAGTGTTTGGTGAAGGTTGAGGG - Exonic
1084738561 11:71122497-71122519 TAGTGTGGAGGGTTGGGGGAGGG + Intronic
1084998409 11:73006232-73006254 TAGGGTTTAGGGAAGGTGTCTGG - Intronic
1085542800 11:77288278-77288300 CAGTGTGCAGGGCAGGTGGGTGG - Intronic
1085864567 11:80274404-80274426 TAGAGTGGAGGGCAGGAGGAGGG - Intergenic
1086100428 11:83093626-83093648 TATTGTGTTGGGTAGATGGATGG + Intergenic
1086453656 11:86941143-86941165 AAATATGTAGGGAAGGTGGAGGG - Intronic
1086961426 11:92982800-92982822 GTGTGTGTAGGGAAGGTCAATGG - Intronic
1087880724 11:103413004-103413026 TAGTCTGGAGGGTAGGTGGGGGG - Intronic
1087949062 11:104197740-104197762 TAATGTGTGGGGAGGGTGGGAGG - Intergenic
1087953184 11:104251235-104251257 TGGGGTGGAGGGAGGGTGGAGGG - Intergenic
1088710878 11:112507447-112507469 TAGGCTCTGGGGAAGGTGGAAGG - Intergenic
1089089378 11:115856782-115856804 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1091669844 12:2445143-2445165 TAGGGAGTAGGGAATGTGGAGGG - Intronic
1092783884 12:12010727-12010749 GTGTGTTTAGGGAAGATGGATGG - Intergenic
1092972644 12:13712229-13712251 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1093427356 12:19043630-19043652 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1094539364 12:31350400-31350422 TAGTGTATGGGGAAGGAGAATGG - Intergenic
1096137812 12:49217160-49217182 TAGTTTGTAGAGTAGGGGGAGGG + Intronic
1096345840 12:50845719-50845741 TAATCAGTAGGGAGGGTGGAGGG - Intronic
1096835828 12:54350668-54350690 AAGGGTGTAGGGGAGGTTGAGGG - Exonic
1096842899 12:54390257-54390279 TATTGTGGAGGCAGGGTGGAGGG + Intronic
1096852545 12:54450537-54450559 TAGTCTGTTGGTAAGTTGGATGG - Intergenic
1097774907 12:63634063-63634085 TAGGGTGCGGGGAAGGGGGAGGG + Intronic
1099026014 12:77465277-77465299 TGGGGTGTTTGGAAGGTGGAGGG + Intergenic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099189003 12:79544029-79544051 TGATGTGTAGGGAAGGTAGGGGG - Intergenic
1100293069 12:93235786-93235808 CAGTGGGAAGGGAAGCTGGAAGG - Intergenic
1100992552 12:100266876-100266898 AAATGTGCAGTGAAGGTGGAGGG - Intronic
1101183109 12:102241242-102241264 TGGGGTGGAGGGATGGTGGAGGG + Intergenic
1101231186 12:102743240-102743262 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1101421048 12:104551362-104551384 TAGTGTGCAGGGAAGTTGGCTGG + Intronic
1101434433 12:104652883-104652905 GAGTGTGTAGGGAGCGTGTAGGG - Intronic
1101720442 12:107346117-107346139 CAGTGTGCAGGGCAGCTGGATGG - Intronic
1102317810 12:111904250-111904272 TGGTGTCTAGGCAGGGTGGATGG + Intergenic
1103118441 12:118359430-118359452 TAGTATGCAGGGAGAGTGGAGGG - Intronic
1103868975 12:124077392-124077414 TTGTGTGTGGGGTAGGTTGACGG + Intronic
1104500025 12:129276131-129276153 TAGGGGTTAGGGAGGGTGGAGGG - Intronic
1104508961 12:129358580-129358602 CAGTCTGTAGGGGAGGTGGGAGG + Intronic
1104749988 12:131232156-131232178 TAATGTGTATGGAACATGGAAGG - Intergenic
1104782727 12:131432288-131432310 TAATGTGTATGGAACATGGAAGG + Intergenic
1105259184 13:18766293-18766315 TAGGGTGGTGGGAAGGTGGTGGG - Intergenic
1105607317 13:21936902-21936924 GTGTGTGTAGAGAAGGTGGGTGG + Intergenic
1105836723 13:24218319-24218341 TAATCTGTAGGGAAGGAAGAGGG + Intronic
1106368448 13:29106898-29106920 TGGTATGCAGGGAAGGTGGGAGG - Intronic
1106726316 13:32490061-32490083 ATGTGTGTAGGGGAGGGGGATGG - Intronic
1108104750 13:46997263-46997285 TAGGGAGTGGGGATGGTGGAGGG - Intergenic
1108355204 13:49623810-49623832 TGGTGGGTAGGAAAGGTGGATGG + Intergenic
1108709591 13:53019451-53019473 TATTGTGTAGGCAGGTTGGAAGG + Intergenic
1109409739 13:61946238-61946260 TGGGGTGTGGGGAAGGGGGAGGG + Intergenic
1109773154 13:67003907-67003929 TAGTCTCTAGGGAAGGCAGATGG + Intronic
1110334627 13:74313244-74313266 GAGTGTGGAGGGTAGGAGGAGGG - Intergenic
1110699677 13:78532035-78532057 TAGGGTGGAGGGACGGGGGAGGG + Intergenic
1110754914 13:79161509-79161531 TAGTATGGAGGGAGGGGGGAGGG + Intergenic
1110806366 13:79758774-79758796 TAGTGGGTGGGGTATGTGGATGG - Intergenic
1111370350 13:87308876-87308898 TAGTCTGTAGGCAAGGAGGGTGG + Intergenic
1112740991 13:102472484-102472506 AAGAGTGCAGGGATGGTGGACGG + Intergenic
1113357800 13:109600075-109600097 TAGTGTGCGGGGATGGTGCAGGG - Intergenic
1113572462 13:111368399-111368421 AAGTGTGTGGGGTAGGGGGACGG + Intergenic
1113939792 13:114012656-114012678 CAGTGTGTGGGGAGTGTGGAAGG - Intronic
1114015023 14:18420593-18420615 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1114235009 14:20815771-20815793 TGGTGTGTAGGGAAGGGAGGGGG + Intergenic
1114713307 14:24800144-24800166 GAGTGAGTTGGGAAGGTGGCTGG + Intergenic
1114829158 14:26118377-26118399 TAGAGTGGAGGGTAGGCGGAGGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115762536 14:36589874-36589896 CAGGGTGAAGGGAAGGAGGAAGG + Intergenic
1116363158 14:44027078-44027100 TGGGGTGGAGGGAGGGTGGAGGG + Intergenic
1118164326 14:63321262-63321284 TAGATTGAAGGGAAGGTGGCAGG - Intergenic
1118334406 14:64840695-64840717 AAGTGTGTGGGGATGGTGAAGGG - Intronic
1118441744 14:65818516-65818538 TTGTGTGTGGGGAGGGTGGGGGG - Intergenic
1120033451 14:79668693-79668715 TGGTGTGTAAGGAAGGGGGCGGG + Intronic
1120492656 14:85196200-85196222 TAGGCTGTGGGCAAGGTGGATGG + Intergenic
1120608402 14:86608617-86608639 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1121610130 14:95273057-95273079 TAGTGTGTAGGGGAGGGTGTAGG - Intronic
1122299403 14:100723404-100723426 TAGTGTTTAGAAAAGGAGGAGGG + Intergenic
1122651492 14:103229363-103229385 TAGGGTGTGGGGCAGGAGGAAGG - Intergenic
1124896238 15:33780051-33780073 TAGTGTCTAGAGAAAGAGGAGGG + Intronic
1125608525 15:40955987-40956009 TGGTGTGGTGGGCAGGTGGAGGG + Exonic
1126426227 15:48529466-48529488 GAGTGTGGAGGGCAGATGGATGG + Intronic
1127022858 15:54769426-54769448 GAGGGTGGAGGGAAGGAGGAGGG + Intergenic
1128878638 15:71223077-71223099 CAGTGTGTCTGGCAGGTGGAAGG - Intronic
1128941315 15:71790173-71790195 GAGTGTGTCGGGAGGGTGCAGGG - Intergenic
1130006998 15:80109175-80109197 TGGTGTGCAGGTAAGGTGGCAGG + Intronic
1131294897 15:91139187-91139209 TGGTGTGAAGGGAAGGAGGTTGG + Intronic
1131580327 15:93636611-93636633 TCGGGTGTGGGGAAGGGGGAGGG - Intergenic
1131779791 15:95843831-95843853 CAGGGTGAAGGGAAGATGGATGG - Intergenic
1131786229 15:95914003-95914025 CACTGTGTAGGGAGGGGGGATGG + Intergenic
1131822001 15:96283180-96283202 AAGTATGTAGGGAAGGAGAAGGG + Intergenic
1133187680 16:4111715-4111737 TAGGGAGTAGGGAAGATAGAAGG - Intronic
1135416087 16:22268988-22269010 GAGGATGTGGGGAAGGTGGAAGG - Intronic
1135859049 16:26038310-26038332 AATAATGTAGGGAAGGTGGAAGG - Intronic
1137628118 16:49922198-49922220 CAGTATTTAGGGAAGGTGAAAGG - Intergenic
1137869794 16:51938969-51938991 TAGGGAGTGGGGAAGGTAGAAGG - Intergenic
1141173328 16:81704440-81704462 AAGTGGGTAGGGGAGGGGGAGGG - Intronic
1141895892 16:86958667-86958689 TGGTGAGGAGGGGAGGTGGAGGG - Intergenic
1142110331 16:88327689-88327711 GAGTGTGCACGGAAGGTGGGAGG - Intergenic
1142244756 16:88964968-88964990 TGGTGGGTGGGGTAGGTGGATGG - Intronic
1142966313 17:3583916-3583938 TAGTGCTTAGGAAATGTGGATGG - Intronic
1143109420 17:4545005-4545027 TGGTGAGTGGGGGAGGTGGAGGG - Exonic
1143983316 17:10889737-10889759 TAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1144232263 17:13219903-13219925 AAGGGTGGAGGGCAGGTGGAGGG - Intergenic
1144590879 17:16522724-16522746 TAGTCTGTAGGGGAGGCTGAGGG - Intergenic
1144802736 17:17941878-17941900 TACTAGGGAGGGAAGGTGGAAGG + Intronic
1146110949 17:30089081-30089103 TGGGGTGGAGGGAAGGGGGAGGG - Intronic
1146593835 17:34152837-34152859 TAGAGTGGAAGGAAGGAGGAGGG - Intronic
1147850016 17:43435188-43435210 CAGTGTCAAGGGGAGGTGGATGG + Intergenic
1148274037 17:46287686-46287708 TAACGGGTAGGGAACGTGGAAGG + Intronic
1148473005 17:47907162-47907184 GAGTGAGTAGGGAAGGAGGGAGG + Intronic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148935951 17:51164967-51164989 ATGTGTGTAGTGAAGCTGGAGGG + Intronic
1149448094 17:56729398-56729420 GAGCCTGCAGGGAAGGTGGAGGG - Intergenic
1150500465 17:65646070-65646092 TAGTGGGCAGGGCAGGAGGAAGG - Intronic
1151070616 17:71206303-71206325 TGGGGTGGAGGGAAGGGGGAGGG + Intergenic
1151109230 17:71655272-71655294 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1153168298 18:2286704-2286726 GAGGGTGAAGGGTAGGTGGAGGG - Intergenic
1153399908 18:4672523-4672545 GAGTGTGGAGGGTAGGAGGAAGG + Intergenic
1156926316 18:42584540-42584562 TATTGTGAATTGAAGGTGGAGGG + Intergenic
1157432903 18:47644208-47644230 GAGGGTGAAGGGAAGGTGGTTGG + Intergenic
1158425771 18:57338578-57338600 GAGAGAGAAGGGAAGGTGGAGGG - Intergenic
1158500363 18:57995489-57995511 TAGTGGGAAGGGCAGGTGCATGG + Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1160213272 18:76902520-76902542 GCATGTGTAGGGAAGGTGGTAGG + Intronic
1160618280 18:80150612-80150634 AAGTGTGAAGGGAAGCTGCAGGG + Intronic
1160821128 19:1058693-1058715 TAGTGTGAAGAGAAGGAAGAGGG - Exonic
1162761518 19:12891412-12891434 GAGTGTGGAGGGAAGGAGGGAGG + Intronic
1162958242 19:14111810-14111832 CAGTGGGTGGGGAGGGTGGAGGG + Intronic
1163398046 19:17075627-17075649 TAGTGGGTAGGGGCGGTGGGTGG + Intergenic
1164220526 19:23188934-23188956 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
1165111663 19:33506006-33506028 TAGTGTGTAGGGTATGATGAGGG - Intronic
1166412909 19:42568529-42568551 TGGGGTGGAGGGAAGGGGGAGGG + Intergenic
1168550751 19:57291296-57291318 TTGTGTGCAGTGAATGTGGAAGG + Exonic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
925377544 2:3398968-3398990 TACTGTGCAGGGGAGGTGGGAGG - Intronic
925544836 2:5005147-5005169 TGGTGTGTAGGGAAGGGAGGGGG - Intergenic
926152859 2:10434510-10434532 TAGTGTGTGGGGGATGGGGAGGG + Intergenic
926239815 2:11076878-11076900 TCATGTGTAGGGAATGTGGTTGG + Intergenic
926815260 2:16793486-16793508 TGATGTGTAGGGAAGGTAGGGGG + Intergenic
927152577 2:20204309-20204331 GAGTGTGTTGGGGAGGTGGGGGG + Intronic
928112682 2:28523505-28523527 GAGTGTGAAGGGAAAGTGGCTGG + Intronic
928642839 2:33318694-33318716 TAGCGTGAAAGGAAGGTGGCAGG - Intronic
929096103 2:38264527-38264549 TGGTGTGTAGGGAAGGAGTGTGG - Intergenic
929748812 2:44688708-44688730 TTCTGTGTGGGGAAGGGGGAAGG - Intronic
930263431 2:49172837-49172859 GAGTGTGTAGGGGAGGTGCTAGG - Intergenic
930365619 2:50435802-50435824 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
930568204 2:53049660-53049682 TGGGGTGTAGGGAGGGGGGAAGG + Intergenic
930781582 2:55229258-55229280 TAGAGAGTAAGGAAGGTGGGAGG + Intronic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
930931734 2:56892986-56893008 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
933854987 2:86404319-86404341 CACTGAGTTGGGAAGGTGGAGGG - Intergenic
934547048 2:95226556-95226578 TAGTATGTAGGGATTCTGGAAGG + Intronic
934739013 2:96705631-96705653 TATTGTGGAGGGGAGGTGGGAGG + Intergenic
935799581 2:106680756-106680778 TGGTGTGGGGGGAAGGGGGAGGG - Intergenic
936080700 2:109430587-109430609 TATTGTGCAGGGAAGCTGGAGGG - Intronic
936883613 2:117282900-117282922 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
936917517 2:117655049-117655071 TAGGGTGGGGGGAGGGTGGAGGG + Intergenic
937481767 2:122268993-122269015 TAGTCTGGAGAGAGGGTGGAAGG - Intergenic
937879638 2:126855874-126855896 CTCTGTGTAGGGAAGGTGGGAGG - Intergenic
938137288 2:128769904-128769926 CAGTGTGAAGGAGAGGTGGAAGG + Intergenic
938899670 2:135789516-135789538 AAGGGTGAAGGGCAGGTGGAAGG - Intronic
939712455 2:145540115-145540137 TGGTGTGGGGGGAAGGGGGAGGG - Intergenic
941270549 2:163422006-163422028 TATTGTTAAGGGAAGGTTGAGGG + Intergenic
941622472 2:167793567-167793589 AATTGTGTAGGCAAGGTGCATGG + Intergenic
941986012 2:171512376-171512398 TACTTTGTAGGGAGGGAGGAGGG - Intergenic
942346444 2:175007336-175007358 ATGTGGGTAGGGAAGGTGGTCGG - Intergenic
942760775 2:179394793-179394815 AGGTATGTAGGGAAGGAGGATGG + Intergenic
943732508 2:191317619-191317641 TGGGGTGGAGGGAAGGGGGAGGG - Intronic
943950273 2:194125538-194125560 TAGGGTGAAGGGTGGGTGGAGGG - Intergenic
944440548 2:199739264-199739286 TAGAGGGTAGGGAAAGAGGAAGG - Intergenic
945503894 2:210613944-210613966 GAGAGTGTAAGGACGGTGGAGGG + Intronic
946452099 2:219789078-219789100 GAGTGGGGAGGGAAGGAGGAAGG - Intergenic
947811873 2:233009870-233009892 TGGAGTGGAGGGAAGGTGGAGGG - Intronic
948360911 2:237419532-237419554 AAGTGTTTAGGGAATGGGGAGGG - Intergenic
1168787828 20:555274-555296 AAGTGTGTAGGGAAAATGAATGG + Intergenic
1169654447 20:7907528-7907550 TAGTTAATAGGGAAGGTGAAGGG - Intronic
1170243091 20:14191973-14191995 TAGTTTGTGGGGGAGGGGGAGGG + Intronic
1170325172 20:15149160-15149182 TGGTGTGTAGGGAAGGGAGGGGG + Intronic
1170528094 20:17261116-17261138 GAGTGTGTAGGTATGGGGGATGG - Intronic
1171118881 20:22550941-22550963 CAGTGGGGAGGGAAGGTGAAGGG - Intergenic
1171266175 20:23773748-23773770 AAGTGTGTGGGGGAGGTGCATGG - Intergenic
1171409782 20:24938353-24938375 TAGTGTGTCTGGAAGAGGGAAGG + Intergenic
1171436157 20:25126223-25126245 TAGTGTGTCTGGAAGAAGGAAGG - Intergenic
1171872063 20:30536452-30536474 TAGGGTGGAGGGAAGGGGGAGGG - Intergenic
1172114017 20:32563150-32563172 TGGAGTGCAGGGAGGGTGGAGGG + Intronic
1172271779 20:33659256-33659278 CAGTGTGGACGGAAGCTGGAGGG - Intronic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174033429 20:47650033-47650055 CAGTGTGTTGGGGTGGTGGAGGG - Intronic
1174848373 20:53966784-53966806 TGGTGTGTATGGAATGTGAATGG - Intronic
1174950789 20:55039707-55039729 TGGAGTGTAGGGAAAATGGAGGG - Intergenic
1175351931 20:58328756-58328778 TCTTGAGTATGGAAGGTGGAAGG - Intronic
1175437461 20:58963687-58963709 TAATGTGTTGGTAAGGTGTAGGG - Intergenic
1175576034 20:60061402-60061424 TAGTGGGTAGGGGAAGAGGAGGG + Intronic
1177664826 21:24141176-24141198 GAGTGGGGAGGGAAGGAGGAGGG + Intergenic
1178681577 21:34676601-34676623 TGGTATGAAGGGAAGGGGGATGG + Intronic
1178926542 21:36780094-36780116 AATTGTGTGGGGTAGGTGGATGG - Intronic
1179264636 21:39792379-39792401 TAGGGTGGGGGGAAGGGGGAAGG + Intronic
1179714297 21:43279870-43279892 AAGTGTCGAGGGCAGGTGGAGGG + Intergenic
1179714477 21:43280286-43280308 TAGAGGGAAGGGGAGGTGGAGGG + Intergenic
1179714695 21:43280786-43280808 TGGAGGGGAGGGAAGGTGGAGGG + Intergenic
1180115099 21:45697988-45698010 TAGTGTGTAGGGAAGGTGGATGG - Intronic
1180239478 21:46490734-46490756 TAGGCAGTGGGGAAGGTGGACGG + Intronic
1180439523 22:15351370-15351392 CAGTGTGTGGGGATGGGGGAGGG - Intergenic
1182123934 22:27802918-27802940 GTGTGTGTAGGGAAGGAGGGGGG + Intergenic
1183468548 22:37993054-37993076 AAGAGAGTGGGGAAGGTGGAGGG + Intronic
1183660338 22:39216297-39216319 TAGTGTCCAGGGAAGGTGTCTGG + Intergenic
1183705852 22:39474551-39474573 CAGTGTGCAGGGAAGGTGCTTGG - Intronic
1184642398 22:45879495-45879517 AAGTGTGTAGGGAGGAGGGAGGG - Intergenic
1184940415 22:47760793-47760815 TACTGTGAAGGGAGGGTGAAGGG + Intergenic
1185160965 22:49229648-49229670 TAGTGTGTATGGCACGGGGAGGG - Intergenic
949287498 3:2424206-2424228 TAGGGTGGAGGGAGGGGGGAGGG - Intronic
949334008 3:2953586-2953608 CAGTGTTTAGGTAAGTTGGAAGG - Intronic
949571987 3:5302306-5302328 TATAAGGTAGGGAAGGTGGAGGG - Intergenic
950854228 3:16090468-16090490 TAGTGTGTGTGGAAGGAGGAGGG + Intergenic
952132950 3:30385298-30385320 CAGTGTGGAGGGAAGGGGGAAGG + Intergenic
953280383 3:41548658-41548680 TAGTGGGCAGGGAGGGTGGGTGG - Intronic
953418269 3:42735266-42735288 CAGAGTGTAGGGAAAGGGGAGGG + Intronic
953599137 3:44346495-44346517 TGATGTGTAGGGAAGGGAGAGGG + Intronic
954213657 3:49112209-49112231 TGGTGTGAAGGGAAGGAGCAGGG + Intronic
954743772 3:52775066-52775088 AAGAGGGTAGGGAAGGTGGCTGG - Intergenic
955823924 3:62924915-62924937 TAGTGGGCAGGGAAGCTGGCTGG + Intergenic
956963421 3:74430621-74430643 CAATGTTTAGGGAAAGTGGAGGG + Intronic
957148257 3:76452318-76452340 TTGTGTGGGGGGAAGGGGGAGGG - Intronic
957888310 3:86320313-86320335 GAGGGTGAAGGGAAGGAGGAGGG - Intergenic
958026877 3:88059210-88059232 TAGGGAGGAGGGAAGGGGGAGGG + Intronic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
959129154 3:102331357-102331379 TAGTGGGGAGGGCAGGAGGAAGG - Intronic
959183682 3:103014601-103014623 TAATAGATAGGGAAGGTGGAAGG + Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960755963 3:121012835-121012857 AAGGGTGGAGGGAAGATGGAAGG - Intronic
962466871 3:135668774-135668796 TAGGGTGTGGGGACGGGGGAGGG - Intergenic
963340556 3:144027306-144027328 TGGTGTGTAGGGAGTGGGGAGGG + Intronic
963437111 3:145286036-145286058 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
963632065 3:147745757-147745779 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
964940572 3:162154923-162154945 TGGTGTGTAGGGAAGGGAGGGGG + Intergenic
964983926 3:162716761-162716783 TGATGTGTAGGGAAGGTAGGGGG - Intergenic
965104961 3:164343677-164343699 TAATGTGTAGGGAAGGGAGGGGG + Intergenic
966279681 3:178212444-178212466 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
966767604 3:183477535-183477557 TATTGTGTAGGGTTGGTGTAAGG - Intergenic
967826625 3:193882419-193882441 GATTGTGGAGGGAAGGAGGAGGG - Intergenic
968039245 3:195574509-195574531 CACTGTGTGGGGAAGGTCGAGGG + Intronic
968733569 4:2283602-2283624 ATGTTTGTAGGGCAGGTGGATGG - Intronic
970042353 4:11810444-11810466 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
973213516 4:47642755-47642777 AAGAGTGTAGGGAAGGCAGAGGG + Intronic
973866321 4:55117443-55117465 TCTTGTGGAGGGAAGGAGGAGGG + Intronic
975036762 4:69694242-69694264 TAGGGTGGAGGGAGGGGGGAGGG - Intergenic
975101840 4:70522534-70522556 TGGTGTGGAGGGAAGGGGGCTGG - Intronic
975864805 4:78715405-78715427 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
975867230 4:78736533-78736555 TGGTGTGTAGGGTTTGTGGAGGG + Intergenic
976567926 4:86574046-86574068 TGGGGTGGAGGGAGGGTGGAAGG - Intronic
977708814 4:100101026-100101048 TAGGCTGTAGGGGAGGTAGAAGG + Intergenic
979174444 4:117645604-117645626 TAGTGTTGAGAGAAGGAGGAAGG - Intergenic
979986964 4:127327128-127327150 TTGTGTGTGGGGAGGGGGGAGGG + Intergenic
981178417 4:141709918-141709940 TAGTGTGGGGGGAGGGTGGGAGG - Intronic
981448095 4:144864133-144864155 TAGGGTGGAGGGAGGGAGGAAGG + Intergenic
981459905 4:145001034-145001056 TAGGGTGCAGGGCAGGGGGAGGG + Intronic
981653756 4:147088895-147088917 GAGTGTGGAGGGAAGATGAAAGG - Intergenic
982279435 4:153668243-153668265 TACTGTGGTAGGAAGGTGGAGGG + Intergenic
982455409 4:155603706-155603728 CAGTGTGTGGGGCAGGGGGACGG + Intergenic
983155643 4:164344223-164344245 GAGGGTGGAGGGAAGGAGGAGGG + Intronic
983232774 4:165146371-165146393 TATGGTGGAGGAAAGGTGGATGG - Intronic
983448341 4:167880490-167880512 TGATGTGTAGGGAAGGGGGGAGG - Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
985436023 4:189930230-189930252 TGATGTGTAGGGAAGGGAGAGGG - Intergenic
986673527 5:10164184-10164206 TAGGGTGGAGGGTAGGAGGAGGG - Intergenic
989114976 5:37943535-37943557 TGGTGTGGGGGGAAGGGGGAGGG + Intergenic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990531439 5:56677584-56677606 TAGTAAGTAGGGAAGTTGAAGGG - Intergenic
991748165 5:69768470-69768492 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991799747 5:70348315-70348337 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
991828850 5:70661723-70661745 TAGGGTGGAGGGATGGGGGAGGG + Intergenic
991892103 5:71347746-71347768 TAGGGTGGAGGGATGGGGGAGGG - Intergenic
992787398 5:80183285-80183307 TGGGGTGGAGGGAGGGTGGAGGG + Intronic
993666713 5:90707320-90707342 TAGTGTGTAGGATAGGGGAAGGG + Intronic
993888851 5:93448049-93448071 TGGGGTGGAGGGAAGGGGGAGGG + Intergenic
993956624 5:94242490-94242512 TAATGGGTAGGATAGGTGGAAGG - Intronic
994989827 5:106982531-106982553 TAATGTGTAGGGAAGGGAGGGGG - Intergenic
995122009 5:108546244-108546266 TAGAGGGTATGGAAGCTGGAAGG + Intergenic
995296951 5:110533998-110534020 TGATGTGTAGGGAAGGGAGAGGG - Intronic
996202977 5:120699135-120699157 TGATGTGTAGGGAAGGGAGAGGG + Intergenic
996276932 5:121678177-121678199 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
996302972 5:122009976-122009998 TAGTGGGAAGGGAAGGTTAAAGG - Intronic
996574681 5:124967896-124967918 TGATGTGTAGGGAAGGTGGGGGG + Intergenic
996725423 5:126669768-126669790 TGATGTGTAGGGAAGGTGGGGGG + Intergenic
996957156 5:129197233-129197255 CAGTGGGCAGGGAAGGTGGAGGG - Intergenic
997206505 5:132053478-132053500 TCAGGTGTAGAGAAGGTGGAAGG + Intergenic
997585668 5:135041549-135041571 TAGCGTGCAGGGAGGGGGGAAGG - Intronic
998389571 5:141778816-141778838 GAGTCTGTAGGGAAGCTGGCTGG - Intergenic
998389806 5:141780220-141780242 GAGTCTGTAGGGAAGCTGGCGGG - Intergenic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
1000457520 5:161470154-161470176 TGATGTGTAGGGGAAGTGGAAGG - Intronic
1000457711 5:161472390-161472412 TGTTTTGGAGGGAAGGTGGAGGG - Intronic
1000607282 5:163338570-163338592 TAATGTGTAGGGAAGGGAGGGGG - Intergenic
1002489569 5:179565088-179565110 TAGTGTATAGGGGAGGGGGATGG + Intronic
1002870675 6:1164878-1164900 TAGTGTGGAGGGAAGGCAGATGG + Intergenic
1005776836 6:29142591-29142613 GACTGTGTAGGCAAGGTAGAAGG + Intergenic
1006321881 6:33323975-33323997 TTGTGTTTAGGGAGGCTGGAGGG + Intronic
1007279133 6:40697423-40697445 GAGGGTGTAGGGAAGGTGGAAGG + Intergenic
1008258150 6:49330260-49330282 GAGTGTGTTTGGAAGGTGGACGG - Intergenic
1008333767 6:50275078-50275100 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1008371182 6:50732651-50732673 TAGTGTGTGGGGACCCTGGAAGG + Intronic
1009457393 6:63873143-63873165 TGGGGTGTAGGGAGGGGGGAGGG - Intronic
1009924719 6:70105926-70105948 TAGTCTTTAGGAAAGTTGGAGGG + Intronic
1010582185 6:77613648-77613670 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011718744 6:90133682-90133704 TGGGGTGTGGGGAGGGTGGAGGG - Intronic
1011746888 6:90415066-90415088 TTCTGTGTAGGGAAGGGGGCTGG + Intergenic
1011787617 6:90864511-90864533 TAGGGTGCAGAGAAGGTGGATGG + Intergenic
1011871815 6:91903977-91903999 TAGTGTGAAGGGTGGGAGGAGGG + Intergenic
1012691273 6:102314557-102314579 TACTGGGTGGGGAGGGTGGAAGG + Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1017138459 6:151168582-151168604 GAGTGGTTAGGGAAGGTGGGAGG + Intergenic
1017540175 6:155393599-155393621 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1018458630 6:163976132-163976154 TGGGGTGGAGGGAAGGGGGAGGG - Intergenic
1018785809 6:167107039-167107061 TAATGTGTGGGGATGGTGGAGGG + Intergenic
1018885920 6:167937106-167937128 GAGTGTGTACAGAAGGTGCAGGG + Intronic
1020046836 7:5046464-5046486 TAGAGTGTGGGGCAGGGGGAGGG + Intronic
1020095860 7:5368951-5368973 TGGGGTGTAGGGAAGGGGGAGGG - Intronic
1020703620 7:11513900-11513922 TTGTGTGTAGGGAAAGTGTAAGG - Intronic
1021213794 7:17890034-17890056 GAGGGTCTAGGGAAGGGGGAGGG + Intronic
1021393951 7:20124980-20125002 TGATGTGTAGGGAAGGTGGTGGG - Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022709752 7:32839464-32839486 TAATGTGTAGGGAAGGGAGGGGG + Intergenic
1023464826 7:40442863-40442885 TGGTGTGGGGGGAAGGGGGAGGG - Intronic
1024351218 7:48366898-48366920 CAGTGTGTCGGCAAGGTGGGAGG - Intronic
1027823978 7:83087068-83087090 TAGGGTGGGGGGAAGGGGGAGGG + Intronic
1027836502 7:83250870-83250892 TAGTGGGTGGGGATGGGGGAGGG - Intergenic
1028143971 7:87301129-87301151 GAGTGTAGAGGGAAGGAGGAAGG + Intergenic
1029692139 7:102189590-102189612 AAGTGTGTAGGGATGCTGTAAGG - Intronic
1031247897 7:119340494-119340516 AATTGTATAAGGAAGGTGGAAGG - Intergenic
1031417760 7:121513164-121513186 TAGAGTTTAGGGCAGGAGGATGG + Intergenic
1031704289 7:124961967-124961989 TGGTGTGTAGGGAAGGGAGGGGG + Intergenic
1031777727 7:125922568-125922590 TAATGTGTAGGGAAGGGAGGGGG - Intergenic
1032121232 7:129158534-129158556 TAGAGTGAAGGGTAGGAGGAAGG - Intronic
1032378428 7:131448873-131448895 AAGTGGGGAGGGAAGGAGGAAGG - Intronic
1033837993 7:145338714-145338736 GTGTGTGTAGGGGAGGTAGATGG + Intergenic
1033908242 7:146233606-146233628 TGGTGTGGGGGGAAGGGGGAGGG - Intronic
1034360487 7:150492495-150492517 TAGGGTGGGGGGAAGGGGGAGGG + Intergenic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036773160 8:11592629-11592651 TGGTGTGGTGGGCAGGTGGAGGG - Intergenic
1037056583 8:14449593-14449615 TACTGTGGAGGGACGATGGAGGG - Intronic
1037800584 8:22033019-22033041 TAGTGTGTAGGGTTTGGGGAGGG + Intronic
1039846559 8:41329819-41329841 GAGTGGGAAGGGAAGCTGGAGGG - Intergenic
1039866669 8:41511256-41511278 TAGTTGGTGGAGAAGGTGGAGGG - Intergenic
1040832246 8:51690311-51690333 TAGGGTGTGGGGAAGGGGGAGGG - Intronic
1041160320 8:55035341-55035363 TGGTGTGTAGGGACGTTGGGAGG + Intergenic
1041212144 8:55563367-55563389 TAATGTGTAGGTAAGGTGAGAGG + Intergenic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041358566 8:57025373-57025395 TAGGGTGTAGGGAGAGGGGAGGG + Intergenic
1041738198 8:61133167-61133189 TAGCCTGTAGGGAAGGCAGATGG + Intronic
1041801347 8:61803822-61803844 TGGTGTGTATGGATGTTGGATGG - Intergenic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042706470 8:71669243-71669265 TGGTGTGTAGGGAAGGGAGGGGG - Intergenic
1043069457 8:75620493-75620515 TATTGTCCAGAGAAGGTGGAAGG - Intergenic
1043344491 8:79284197-79284219 TAGAATGTATGGAAGGAGGATGG + Intergenic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043617363 8:82143574-82143596 TAGGGTGGGGGGAAGGGGGAGGG - Intergenic
1044983227 8:97736341-97736363 GAGGGTGAAGGGAAGGGGGAGGG + Intergenic
1045262567 8:100589582-100589604 TAGTGTGTAGGGGAGGTGAGAGG + Intronic
1045603015 8:103739379-103739401 TAGGGTAGAGGGAAGGGGGAGGG + Intronic
1046242252 8:111511467-111511489 TAGGGTGGAGGGAGGGGGGAGGG + Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046709733 8:117496782-117496804 TAGTCAGTAGTGAAGGCGGAGGG - Intergenic
1048930356 8:139310338-139310360 TATTGGGTGGGGAAGATGGATGG - Intergenic
1050075532 9:1858808-1858830 TGGGGTGTAGGGAAGGGGGAGGG - Intergenic
1050809874 9:9731600-9731622 TGGGGTGTAGGGAGGGGGGAAGG - Intronic
1050820916 9:9878865-9878887 GATTGTGGAGGGAAGGAGGAAGG - Intronic
1051819036 9:21143099-21143121 TTTTGTCTAAGGAAGGTGGAAGG + Intergenic
1052334615 9:27306859-27306881 TAGTCTTCAGGGAAGGGGGAAGG + Intergenic
1054902456 9:70383518-70383540 AAATGTGTAGGGAGTGTGGAAGG - Intergenic
1055398945 9:75902368-75902390 TAGTCTGTGAGGAAGGTGGTGGG + Intronic
1055836766 9:80453075-80453097 TAAGGTGTAAGGAAGGTGTAAGG - Intergenic
1055907691 9:81313242-81313264 TAGTGGGTAGTGAAGGCTGAAGG - Intergenic
1056282474 9:85055335-85055357 TGGTGTGTTAGGAAGGTGGTGGG + Intergenic
1056884169 9:90424107-90424129 GAGTGTGCAGTGAAGGGGGAAGG - Intergenic
1057444301 9:95103230-95103252 TGGTGTGTAAGGAAGATGCAAGG - Intronic
1058282414 9:103131909-103131931 TGGGGTGCAGGGAAGGTGGCAGG + Intergenic
1059945821 9:119407247-119407269 GAGGGTGTAGGGTGGGTGGAAGG - Intergenic
1060647233 9:125291392-125291414 TAGTGAGGAGGGCAGGTTGAGGG + Intronic
1061860262 9:133464329-133464351 TGGTGGATAGGGAAGGGGGATGG + Intronic
1061910081 9:133717695-133717717 TTGTGAGTAGGGAAGGGGCATGG - Intronic
1186784363 X:12943994-12944016 TAATGTGTAGGGAAGGGAGGGGG - Intergenic
1187099688 X:16180729-16180751 TAATGTGTAGGGAAGGAAGGGGG + Intergenic
1187635036 X:21218760-21218782 TGGGGTGTAGGGAGGGGGGAGGG - Intergenic
1187936483 X:24341191-24341213 GAGTGGGCAGGGAAGATGGAAGG + Intergenic
1188465868 X:30480311-30480333 TAGGGTTGAGGGAAGGTGAAGGG + Intergenic
1189756642 X:44278628-44278650 GAGTCTATAGGGAAGGAGGAAGG - Intronic
1190091317 X:47439791-47439813 TAGATAGGAGGGAAGGTGGATGG + Intergenic
1192029537 X:67494347-67494369 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1192316242 X:70053936-70053958 TAGAGTGGAGAGATGGTGGAGGG - Intergenic
1193340872 X:80347850-80347872 TAGTGTGTAAGGAAGGGGTCTGG + Intronic
1193456621 X:81739061-81739083 GAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1193581334 X:83266745-83266767 GAGAGTGGAGGGTAGGTGGAGGG + Intergenic
1193584323 X:83301739-83301761 TGGTGTGGGGGGAGGGTGGAGGG + Intergenic
1193682339 X:84538033-84538055 TAGGGTGGCGGGAAGGGGGAGGG + Intergenic
1193855096 X:86590962-86590984 TAGGGTGCGGGGAAGGGGGAAGG - Intronic
1194998990 X:100623884-100623906 TGGGGTGTGGGGAAGGGGGAGGG - Intergenic
1195243884 X:102979157-102979179 TGGCGTGGAGGGAAGGTGGGGGG + Intergenic
1195477513 X:105303636-105303658 TTGTGTGTGGGCAAGCTGGAAGG - Intronic
1195883020 X:109612370-109612392 GAGAGTGGAGGCAAGGTGGAGGG - Intergenic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1197772020 X:130095155-130095177 TGGTGTGCAGGGAAGGTGGCAGG + Intronic
1197908340 X:131451194-131451216 TGGGGTGGAGGGAGGGTGGAGGG + Intergenic
1199095872 X:143737891-143737913 TAGGGTGGAGGGTAGGAGGAGGG + Intergenic
1199293148 X:146127790-146127812 TAATGTGGTGGTAAGGTGGATGG + Intergenic
1201294213 Y:12449899-12449921 TAGTGTGTGGGGAAGGCTGGTGG - Intergenic
1201438458 Y:13985038-13985060 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438492 Y:13985154-13985176 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201438611 Y:13985524-13985546 TGGTGTGTAGGGAGGGAGGGAGG - Intergenic
1201445962 Y:14057184-14057206 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446081 Y:14057554-14057576 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1201446115 Y:14057670-14057692 TGGTGTGTAGGGAGGGAGGGAGG + Intergenic
1202104660 Y:21350611-21350633 TAGTGTGTGGGGATGGGGGAGGG - Intergenic