ID: 1180116649

View in Genome Browser
Species Human (GRCh38)
Location 21:45710733-45710755
Sequence GTGCTCTGCCTCACTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 8, 3: 37, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180116649 Original CRISPR GTGCTCTGCCTCACTGAGGA TGG Intronic
900176807 1:1294717-1294739 GTGGACAGCGTCACTGAGGAGGG - Exonic
900316427 1:2059448-2059470 GTGCTCAGCCTGACTGAGGCGGG + Intronic
900383954 1:2400841-2400863 TTGCTCTGCCTTACAGATGACGG + Exonic
900519542 1:3098953-3098975 CTGAGCGGCCTCACTGAGGAGGG + Intronic
907373416 1:54017474-54017496 GTTGTCTGCCTCCCTGAGGCTGG - Intronic
907428675 1:54397580-54397602 GTGCTCCACCTCAGTGAGGCTGG - Intronic
907799778 1:57753087-57753109 GTGTTCTGCCTGAGTCAGGAGGG + Intronic
912752757 1:112299214-112299236 TTGCTATGCCTCACTGAGACTGG + Intergenic
914967092 1:152269767-152269789 GTGCTCTGTCTCAGGGAGAAGGG + Intergenic
914969275 1:152292350-152292372 GTGCTCTGTCTCAGGGAGAAGGG - Intergenic
915019765 1:152768026-152768048 TTGATCTGCCTCCCTGTGGAAGG + Intronic
915741246 1:158120063-158120085 GAGCTCTGCCTCCCTGGGCAGGG + Intergenic
917602316 1:176588743-176588765 GGGGTCTGGCTCACTGAGGTTGG + Intronic
919888472 1:201952541-201952563 ATGCCCAGCCACACTGAGGAGGG - Intergenic
921170208 1:212540581-212540603 GTGCTTTGCTTGCCTGAGGAGGG - Intergenic
922152643 1:223018680-223018702 GAGAACTGCCTGACTGAGGATGG + Intergenic
922156925 1:223047816-223047838 GTGCCCACCCTCACTGAGGGTGG + Intergenic
922534575 1:226370434-226370456 CTGCTGGACCTCACTGAGGATGG + Exonic
923672006 1:236049033-236049055 GTGCTCAGTCTTACTGAGAAAGG - Intronic
923907381 1:238400301-238400323 GTGCTCACCCGCACTGAGGGTGG + Intergenic
924457595 1:244230963-244230985 GGCCTCTTCCTCCCTGAGGAGGG + Intergenic
1064955773 10:20907751-20907773 GTGTTTTTCCTCACTGATGAAGG - Intronic
1065552564 10:26883965-26883987 CAGCTCTCCCTCACTGAAGATGG + Intergenic
1065600490 10:27362946-27362968 CAGCTCTCCCTCACTGAAGATGG - Intergenic
1066581068 10:36882921-36882943 CAGCTCTGCCTCACTGAAGATGG + Intergenic
1067136578 10:43613774-43613796 GTGCTCTCACACACTGATGAAGG - Intronic
1067684810 10:48459768-48459790 GAGCGCGGGCTCACTGAGGAGGG - Exonic
1070160196 10:73862112-73862134 GAGCTCTGCCTTCCTGTGGAAGG - Intronic
1071278226 10:84075895-84075917 GTTCTCTGACTCAGAGAGGATGG - Intergenic
1071881108 10:89898831-89898853 GGTTTCTGTCTCACTGAGGAAGG - Intergenic
1073572106 10:104589367-104589389 ATCCTCCCCCTCACTGAGGAAGG - Intergenic
1075868119 10:125745120-125745142 CTGCTCTGCCTCACCCAGGATGG - Intronic
1076000825 10:126911727-126911749 GGGCTTTGCTTCACTGAGGTTGG + Intronic
1076335518 10:129703967-129703989 CAGCTCTGCATCACTCAGGAGGG + Intronic
1076903421 10:133350871-133350893 GTCCTTTGCCCCACTGAGGATGG + Intronic
1077054900 11:586749-586771 GTGCTCTGCCTCCCACAGGGAGG + Intronic
1077115046 11:880347-880369 GCGCTCTGGGTCACTGAGCAGGG - Intronic
1077358946 11:2131251-2131273 GTGCCCTGCCTCTCAGAGGAGGG - Intronic
1077744924 11:4891721-4891743 GTGCTCTCCATCTTTGAGGATGG + Intronic
1078092940 11:8278567-8278589 GTAGTCTGCCACACTCAGGAAGG - Intergenic
1078355334 11:10628301-10628323 GTGCCCTGCCGCACTGATGAGGG + Intronic
1078450055 11:11434051-11434073 CTGCTCTTCCTTAATGAGGAAGG + Intronic
1080676895 11:34436283-34436305 ATTCTCGGCCTCTCTGAGGATGG + Intergenic
1085532378 11:77199579-77199601 GTGCTGCGCCTCACTCAGGCTGG + Exonic
1085640949 11:78192336-78192358 GCACTCTGCCTCCCTCAGGAGGG - Intronic
1086722997 11:90144966-90144988 GTGTTCTCCCTCTCTCAGGAGGG + Intronic
1087069992 11:94068945-94068967 ATGCTATGACTCACTGTGGAAGG - Intronic
1087100274 11:94357068-94357090 GTGCCCACCCTCATTGAGGATGG - Intergenic
1087615801 11:100485939-100485961 CTGCTCTGTCTGTCTGAGGAGGG - Intergenic
1088547265 11:110972275-110972297 GTGCCATGGCTCACAGAGGATGG - Intergenic
1089305113 11:117521691-117521713 TCCCTCTGGCTCACTGAGGAGGG + Intronic
1089363215 11:117904589-117904611 TTGCTCTGCCTCACGGAGGGAGG + Intronic
1089691726 11:120191091-120191113 GTTCTGTGCCACAGTGAGGAGGG - Intergenic
1091699778 12:2651871-2651893 GAGTTCTGCCACACAGAGGAAGG - Intronic
1094450479 12:30578408-30578430 GTGCTGTTCCTCACAGAGCAGGG - Intergenic
1094490965 12:30960349-30960371 GGGCTCCTCCTCACTGAGGGTGG + Intronic
1095501504 12:42845075-42845097 TTTCTCTCCTTCACTGAGGAAGG + Intergenic
1096677286 12:53232446-53232468 GTGCCCGGCCTCCCAGAGGATGG - Intronic
1096941885 12:55355750-55355772 GTGCTCTGCCTCAGGGAGATCGG - Intergenic
1097087300 12:56477932-56477954 AAGCTCTCCCTCAATGAGGAAGG - Exonic
1097733075 12:63151256-63151278 GTCCTCTGCATCACTGTGGAGGG + Intergenic
1100190604 12:92187143-92187165 ATGTTCTGCCTCACTGACAATGG + Intergenic
1101430049 12:104619254-104619276 ATGCTCTGTCTGACTCAGGAGGG - Intronic
1102482597 12:113233921-113233943 GAGCTCTACCTCACGGAGGGGGG - Intronic
1102689537 12:114749564-114749586 GTGCTCTGGCAGACAGAGGATGG + Intergenic
1102789677 12:115634436-115634458 GTGCTCACCCACACTGAGGATGG + Intergenic
1103807157 12:123582576-123582598 CTACTCTGCCTCACTCATGAAGG - Intergenic
1105241542 13:18613140-18613162 GTGCTCTGGGTCACTGAGGAAGG + Intergenic
1106016282 13:25872149-25872171 GTCCTCTGCCTCACTGACCATGG + Intronic
1106582334 13:31028976-31028998 CTGCCCTCACTCACTGAGGAAGG - Intergenic
1108722298 13:53144894-53144916 GTGTGCTGCCTCCATGAGGAGGG + Intergenic
1110949990 13:81473988-81474010 GTGCTTTTGCACACTGAGGAAGG + Intergenic
1112610831 13:100953114-100953136 CTGCTCTCCCTCACAGAGGTGGG + Intergenic
1113346713 13:109485338-109485360 GTTCTCTGCCTCACAGGTGATGG + Intergenic
1114084419 14:19229132-19229154 CTCCTCTGCCTCACTGAAGAGGG - Intergenic
1115008141 14:28511388-28511410 GTGCTCTGTCTCAGTGAGATGGG + Intergenic
1116747860 14:48844899-48844921 GTGCCCAGCCACACTGAGGGTGG - Intergenic
1117286854 14:54294087-54294109 ATGGTCTGCCTGCCTGAGGATGG + Intergenic
1117984219 14:61371815-61371837 ATGCTCTACCTCCCTGAGGGAGG + Intronic
1118343939 14:64920472-64920494 GAACTGTGCCTCACTGATGAAGG + Intronic
1119185903 14:72642393-72642415 GTGCTGGGCCTCACTGTGGCTGG - Intronic
1121334920 14:93071353-93071375 GTGCTGTCCCTCTCCGAGGAAGG + Intronic
1122162133 14:99792791-99792813 GTGCTAAGTCTCACTGAGGCAGG + Intronic
1122986117 14:105212468-105212490 GTGCCCTACCTCACTCAGGGAGG + Intronic
1123114305 14:105886951-105886973 GGGCTCTGCCTCCCTGTGCATGG + Intergenic
1123120730 14:105915222-105915244 GGGCTCTGCCTCCCTGTGCATGG + Intergenic
1202896023 14_GL000194v1_random:10976-10998 CTCCTCTGCCTCACTGGAGAGGG - Intergenic
1123489809 15:20772006-20772028 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1123546308 15:21341093-21341115 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1123944513 15:25232590-25232612 CTGGGCTGCCTCATTGAGGAGGG - Intergenic
1123985828 15:25645054-25645076 GTCCTCTGCATCCCTGAAGAAGG + Intergenic
1124374838 15:29123429-29123451 GTGCTGTGCCTCGGTGGGGAGGG + Exonic
1126412329 15:48385157-48385179 CTGCTCTGCTTCACTGACCAGGG + Intergenic
1126469301 15:48990714-48990736 GGGCTTTGCCTCACAGAGGCAGG - Exonic
1126779912 15:52130671-52130693 GTGGTCTCCCTCACACAGGAGGG + Intronic
1126951112 15:53882807-53882829 GTGTTCTTCTCCACTGAGGATGG + Intergenic
1129356778 15:74996717-74996739 ATGTTCTGCCTCACGGAGCAGGG + Intronic
1129995996 15:80006709-80006731 GTGTTCTTACTCACTGATGAAGG - Intergenic
1131749133 15:95487157-95487179 TTTCTCTTCATCACTGAGGAAGG - Intergenic
1132043556 15:98546042-98546064 GTGCTCTGCCCCACTGAGCCTGG - Intergenic
1202954635 15_KI270727v1_random:68308-68330 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1132642252 16:983251-983273 GTCCTGTGGCTCAGTGAGGACGG + Intronic
1132657406 16:1046996-1047018 GTGGTCTGCCTGCCTGAGGGTGG + Intergenic
1134571702 16:15296926-15296948 GTGCTCTGACTTACAGAGCAAGG - Intergenic
1134730680 16:16459117-16459139 GTGCTCTGACTTACAGAGCAAGG + Intergenic
1134936751 16:18252779-18252801 GTGCTCTGACTTACAGAGCAAGG - Intergenic
1135159912 16:20084901-20084923 TTGCTCTGCCTCACTTAGTCTGG - Intergenic
1135382128 16:22004123-22004145 GTGCTCAGGCTCTCTAAGGATGG + Intergenic
1135486796 16:22872698-22872720 ATGGACTGCCTCATTGAGGATGG + Intronic
1135909878 16:26550135-26550157 GTGCTCTGGCTGACAGAGAAGGG + Intergenic
1136576650 16:31129284-31129306 CTGCTCTGCCTTCCTGAGCATGG + Intronic
1136859595 16:33690216-33690238 GTGCTCTGCTTCAGTGTGGAGGG - Intergenic
1139451802 16:67033564-67033586 GTGCAGTGGCTCACTGAGGCAGG - Intronic
1139592628 16:67942005-67942027 GGGATGTGCTTCACTGAGGATGG - Intronic
1139736808 16:68997197-68997219 GTTCTTGGCTTCACTGAGGAAGG + Intronic
1141253887 16:82383131-82383153 GATCTCTGCCCTACTGAGGATGG + Intergenic
1141647336 16:85374802-85374824 GCCTTCTGCCTCACTGAGGACGG + Intergenic
1203121101 16_KI270728v1_random:1538395-1538417 GTGCTCTGCTTCAGTGTGGAGGG - Intergenic
1142478511 17:204151-204173 GTGCTCTGCATCCCTAGGGAGGG - Intergenic
1142848787 17:2694552-2694574 GTCCACGGTCTCACTGAGGAGGG + Exonic
1143588297 17:7863377-7863399 CTGCTGTGATTCACTGAGGACGG - Intronic
1147317450 17:39627591-39627613 GGGCTCTGCCTCGGTCAGGACGG + Intronic
1147893988 17:43738432-43738454 ATGCTCATCCTTACTGAGGAGGG - Intergenic
1148858580 17:50592362-50592384 CTGGTCTGCCTCTCTGGGGAAGG - Intronic
1150712859 17:67546542-67546564 GGGTTCTGCCTCACTGCTGATGG + Intronic
1151115008 17:71725755-71725777 GTTCTCTTCCTAACTGAAGAAGG + Intergenic
1151444955 17:74157422-74157444 GTGCCCACCCACACTGAGGATGG - Intergenic
1153413099 18:4815992-4816014 GTCCTCTTCCACACTGTGGAGGG + Intergenic
1154447415 18:14446766-14446788 GTGCTCTGGGTCACTGAGGAAGG - Intergenic
1154470243 18:14693506-14693528 CTGCTATGCCTCACTGGGTAGGG - Intergenic
1156169785 18:34468799-34468821 ATGCTCTGCCTCCTTGACGATGG + Intergenic
1156991927 18:43419571-43419593 ATCCTGTGCCTCAGTGAGGAAGG + Intergenic
1157445666 18:47745229-47745251 GTGCTCAGCCTCAGAGAGGAAGG - Intergenic
1157605580 18:48924071-48924093 GTGCTGTGCCTCCCGGAAGAGGG - Intronic
1157995496 18:52549909-52549931 ATGCTCTACCTCATTGAGAAAGG - Intronic
1158375245 18:56856164-56856186 GAGCTCTGCCTCACAGCAGATGG + Intronic
1160291721 18:77600862-77600884 ATGCTCTGACTCACAGAGGCAGG + Intergenic
1161915273 19:7223672-7223694 ATACTCTGCCTTACAGAGGAAGG - Intronic
1162141590 19:8588688-8588710 CTCCTCTGGCTCACAGAGGATGG + Intronic
1162573011 19:11483338-11483360 GTTCCCTGCCTCGCTTAGGAAGG + Intronic
1162823123 19:13235347-13235369 GTGCTCTGCCCCACTGGGTTGGG + Intronic
1164286413 19:23821468-23821490 CTGGTCTGCCTCCCAGAGGAGGG + Intronic
1164668897 19:30062126-30062148 GGGCACTGCCTCCCTGAAGATGG + Intergenic
1165638479 19:37363988-37364010 CTGCCCTTCCTCACTGTGGATGG + Exonic
1166009139 19:39928137-39928159 GTTGTCTGCCTGGCTGAGGATGG + Exonic
1166256581 19:41610427-41610449 GTGCCCTTCCTAACTGAGGGAGG + Intronic
1166782295 19:45348969-45348991 GTGCTCAGCATCCCTGGGGAGGG - Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168351421 19:55678322-55678344 ATACTCTGCCTCACTGAGCAGGG + Intronic
925011527 2:489005-489027 ATGTTTTGCCTCAGTGAGGAGGG - Intergenic
926388531 2:12363002-12363024 GTGCCCACCCTCACTGAGGGTGG - Intergenic
926942676 2:18154774-18154796 GTGCCCGCCCTGACTGAGGATGG + Intronic
927154140 2:20212171-20212193 GTGCTGTGGGTCCCTGAGGAGGG - Intronic
928172726 2:29013738-29013760 GTGCCCACCCACACTGAGGATGG + Intronic
928397949 2:30957490-30957512 AAGCTCTTCCTCACTGGGGAAGG + Intronic
928436675 2:31259018-31259040 CTGCCCTGCCTCACAGAGGGAGG - Intronic
931179055 2:59881678-59881700 GTCCTTTGCCTTCCTGAGGAAGG - Intergenic
931800093 2:65749740-65749762 TTTCTCAGCCTCACTGAGCAGGG + Intergenic
932416764 2:71578301-71578323 ATGCTCTGCCTCTCTCAGAAGGG - Intronic
932705450 2:74020960-74020982 GTCCTCTGCCACCCTGAGCATGG - Intronic
932818456 2:74879971-74879993 CTCCTCTTCCTCACTGAAGAAGG - Intronic
934620716 2:95803003-95803025 CAGCTCTGCCTCACTGAGGATGG - Intergenic
934812723 2:97296714-97296736 CAGCTCTGCCTCACTGAGGATGG + Intergenic
934824971 2:97411758-97411780 CAGCTCTGCGTCACTGAGGATGG - Intergenic
936547273 2:113403542-113403564 CAGCTCTGCCTCACTGAGGATGG + Intergenic
936615649 2:114045103-114045125 GTCCTGTCCCTCATTGAGGAGGG - Intergenic
936779250 2:116012432-116012454 ATCCTCTGCCTCACTGAGGCTGG - Intergenic
936926448 2:117741728-117741750 GTGCACTGCCTCACAGAGGCAGG - Intergenic
938323151 2:130378922-130378944 TTGTTCAGCCTCAGTGAGGAAGG - Intergenic
938492166 2:131766967-131766989 CTCCTCTGCCTCACTGGAGAGGG + Exonic
938495401 2:131795376-131795398 CTCCTCTGCCTCACTGGAGAGGG - Exonic
938934249 2:136115382-136115404 GTCATCTGCCTCACTGACGTTGG + Exonic
939125634 2:138174236-138174258 TTCCTCATCCTCACTGAGGATGG - Intergenic
940593969 2:155766713-155766735 GTGCTCTGCCCCATGGAGGTGGG + Intergenic
944587612 2:201186379-201186401 GGGCTCTGCCACACTGAGGTGGG - Intronic
946054122 2:216886053-216886075 GTTCTCTTCCACACTGTGGAGGG + Intergenic
946196298 2:218034588-218034610 GTGCTCTGCCTCCTTGAGCCTGG - Intergenic
946200568 2:218068645-218068667 GTGCTCTGCCTCCTTGAGGCTGG - Intronic
947404278 2:229758146-229758168 TTGCTCACCCTCACTGATGATGG - Intergenic
947537280 2:230948128-230948150 GTGCTTTGCCTCACCAAGGGAGG - Intronic
948185858 2:236020839-236020861 GTGCTGCTCATCACTGAGGAGGG - Intronic
1169907695 20:10620012-10620034 CTGCCCTGCACCACTGAGGATGG - Intronic
1171227200 20:23451660-23451682 TTGCTTTCCCTCTCTGAGGAAGG + Intronic
1171310429 20:24140797-24140819 CTACTCATCCTCACTGAGGAAGG - Intergenic
1173057418 20:39628876-39628898 GTGCCCTGCCTGACTAGGGAGGG + Intergenic
1173722220 20:45269323-45269345 GTTCTCTGCCTCCCACAGGAGGG + Intergenic
1175105653 20:56612975-56612997 CTGCTCAGCCTCACTCAGGGTGG + Intergenic
1175719177 20:61275010-61275032 GTGCTCTCCCTAACTGCGCATGG - Intronic
1175936996 20:62518493-62518515 GTCCTCTGCCTCTGTGAGGGGGG + Intergenic
1176448780 21:6843903-6843925 GTGCTCTGGGTCACTGAAGAAGG + Intergenic
1176615715 21:9027028-9027050 CTCCTCTGCCTCACTGGAGAGGG - Intergenic
1176709455 21:10136775-10136797 CTCCTCTGCCTCACTGGAGAGGG + Intergenic
1176804252 21:13464360-13464382 CTGCTATGCCTCACTGGGTAGGG + Intergenic
1176826950 21:13708926-13708948 GTGCTCTGGGTCACTGAAGAAGG + Intergenic
1179779523 21:43690448-43690470 GTGCTGTGCCACTCTGGGGAGGG - Intronic
1180116649 21:45710733-45710755 GTGCTCTGCCTCACTGAGGATGG + Intronic
1180293553 22:10864070-10864092 CTCCTCTGCCTCACTGAAGAGGG + Intergenic
1180496358 22:15893485-15893507 CTCCTCTGCCTCACTGAAGAGGG + Intergenic
1181715680 22:24725875-24725897 ATGTTCCCCCTCACTGAGGAAGG + Intronic
1182487991 22:30650755-30650777 GTGCTCTGGCAGGCTGAGGAGGG - Intronic
1182870346 22:33640938-33640960 GTGCTCTGTCTCACGGAGATGGG - Intronic
1183075444 22:35423690-35423712 GCTTTCTGGCTCACTGAGGAGGG + Intronic
949952166 3:9238314-9238336 ATGCCCTCCCTGACTGAGGAGGG - Intronic
951350868 3:21605321-21605343 CTGCTGTGCCTAACTCAGGAGGG - Intronic
952520365 3:34151088-34151110 TTGCTTTGCCTCTCTGAGCACGG + Intergenic
953536908 3:43783453-43783475 ATGCTCTGCCCCGCTCAGGAAGG - Intergenic
955175065 3:56605889-56605911 GTGCTCTGCCTCAGAGAGGTAGG + Intronic
955343446 3:58143408-58143430 GGGCTCTGCTTCTCTGGGGAAGG + Intronic
955807243 3:62749855-62749877 GTGCCCTGACGCACTGAGGCTGG - Intronic
957215632 3:77317101-77317123 TTGCTCTGGGTCACTCAGGAAGG + Intronic
958415192 3:93865570-93865592 GAGCTCTGCATCAGTGAAGATGG + Intergenic
960569672 3:119173456-119173478 CTGCCCTGCCTCGCTGAGGCGGG - Intronic
966616503 3:181919127-181919149 GTGCTCTGCTTTACAGATGAGGG - Intergenic
968188731 3:196652029-196652051 GAGCCCTGCCACACTGAGGAGGG + Intronic
969376819 4:6768534-6768556 GTCCACTGGATCACTGAGGATGG - Intergenic
969888845 4:10240855-10240877 GTGCCCTTCCAGACTGAGGATGG + Intergenic
971078884 4:23183927-23183949 GTGCCCACCCACACTGAGGATGG + Intergenic
971229782 4:24791925-24791947 GTGCTGTTCCTCAGTGAAGAGGG - Intronic
973629143 4:52802492-52802514 GTGCTCTGTCCCAGTGAGGCGGG - Intergenic
973976933 4:56272122-56272144 GTGCTCTGCCTCCCTGTGCATGG + Intronic
975466305 4:74713578-74713600 GTGCTCTGTCTCAGGGAGGTGGG + Intergenic
977837217 4:101659461-101659483 GTGCTCTTCATTTCTGAGGATGG - Intronic
978927656 4:114268702-114268724 GTGCTCAGCCCCAGTGAGGCTGG + Intergenic
980694472 4:136337449-136337471 CTGCTATGCCTCACTGGGCAGGG + Intergenic
980792139 4:137633385-137633407 GTGCCCACCCACACTGAGGATGG - Intergenic
980874764 4:138650450-138650472 GTGCTCTGCCACTGTGGGGATGG - Intergenic
981012053 4:139935122-139935144 GTTCTGTGCCTTGCTGAGGAAGG - Intronic
982357895 4:154490091-154490113 GTGCTCTTTCTCACAGAGGGAGG - Intronic
983752983 4:171299124-171299146 GTGCCCTTCCACACTGTGGAAGG + Intergenic
984305855 4:177989588-177989610 GTGCTTTCCCTCCTTGAGGATGG - Intronic
984656945 4:182328742-182328764 GTGCTCAGCATTACTGATGATGG - Intronic
984658026 4:182340799-182340821 GTGTTCTGCCTGACTGATGGAGG + Intronic
985220674 4:187700600-187700622 GTGGTTTTCCTCACTGAGGGGGG + Intergenic
986333078 5:6732179-6732201 GTGCACTGCCTCACCCAGGCAGG - Intronic
989160568 5:38386938-38386960 ATGCTCTGCAGCACGGAGGAGGG + Intronic
989464490 5:41739196-41739218 GTGCTCTGACTCACTGGCCAAGG - Intronic
990611010 5:57456922-57456944 GTGGTCAGCCTCCCTGCGGAAGG + Intergenic
991113242 5:62925290-62925312 GTGGTGTGGCTCACTGGGGAAGG + Intergenic
993013193 5:82507406-82507428 ATGCTCAGCCACATTGAGGAGGG - Intergenic
993595139 5:89844816-89844838 TTACTCTGCCTCATTGTGGAGGG - Intergenic
994272738 5:97801469-97801491 ATCCTCTGCATCACTGAGGAGGG + Intergenic
1001593617 5:172883606-172883628 CTGATATGCCGCACTGAGGAGGG - Intronic
1002838353 6:884452-884474 TTGCTCTTCCTCACTGTTGAAGG - Intergenic
1003844834 6:10162285-10162307 GTGCTTTGCCTCTCTGTGGTAGG - Intronic
1004249559 6:14012392-14012414 ATGCCCTTCCACACTGAGGAGGG + Intergenic
1004624204 6:17359423-17359445 GTTTTCTGCCTCACTGAACATGG + Intergenic
1005307793 6:24530588-24530610 GGGTTGAGCCTCACTGAGGATGG + Intronic
1006894630 6:37459479-37459501 GTGCTCTGGGTCAGTGAAGACGG - Intronic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1009581594 6:65541883-65541905 GTGCTCACCATCACGGAGGATGG + Intronic
1012457450 6:99423383-99423405 GTGCTCTTCCTCAGTTAGGGTGG - Intronic
1013116589 6:107108161-107108183 GTGCTCTGACTGAATAAGGAAGG - Intronic
1013844306 6:114430998-114431020 TTGCTATGCCTGACTGAGGCTGG - Intergenic
1014826855 6:126056699-126056721 AAGCTCTGCCTCAAGGAGGATGG - Intergenic
1015760399 6:136653546-136653568 GTGCTCTCCCTCATAGAGAAAGG - Intronic
1016590917 6:145742456-145742478 GTGCTCTGTCTCAGTGAGATGGG - Intergenic
1018739617 6:166717446-166717468 CTGCTCTGCCACCCTGAGAATGG + Intronic
1019314238 7:377207-377229 GTCCTCTGCCACACTCAGGGGGG - Intergenic
1019525660 7:1479366-1479388 GGGCTCTGCCTCCCGCAGGACGG - Intronic
1019571742 7:1716059-1716081 GTGCTCTTCCTCAGTGAGTTGGG + Intronic
1019609336 7:1929081-1929103 CTGCTCGGCCTCAGGGAGGAGGG - Intronic
1019664999 7:2247380-2247402 GTCCCCTGCCCCACAGAGGAGGG - Intronic
1019791583 7:3017468-3017490 TTCCTCAGCCTCACTCAGGATGG - Intronic
1019822786 7:3257970-3257992 CTGCTCTGTCGTACTGAGGAGGG + Intergenic
1019824019 7:3268614-3268636 TTGCTGTGCCTCACTGAGCGAGG + Intergenic
1019868739 7:3737854-3737876 GTGCTCTACCAGACTGGGGAGGG + Intronic
1020124669 7:5526800-5526822 GTGCCATGCCTCACTGGGGCTGG - Intergenic
1023466666 7:40463617-40463639 GCGATCAGCCTCACTCAGGACGG + Intronic
1024513220 7:50219345-50219367 GTGTTCTGCCTTCCTGGGGAGGG + Intergenic
1025106674 7:56176214-56176236 GAACTTTGCCTCACTGAGCAAGG + Intergenic
1025272644 7:57539634-57539656 GTCTTCTGCGTCACTGAGGCTGG - Intergenic
1027475892 7:78631017-78631039 GTGCTCAGCCACCATGAGGATGG - Intronic
1027840792 7:83308444-83308466 GTGCCCACCCACACTGAGGATGG + Intergenic
1028408613 7:90503602-90503624 TTGCTGTGTCTCACTGAAGAGGG + Intronic
1028980235 7:96960034-96960056 ATGCATTGCCTAACTGAGGAAGG - Intergenic
1029290905 7:99501488-99501510 GTGCTCTGCCATGCTGTGGAAGG + Intronic
1033153676 7:138937940-138937962 GTGCTCTGCCGCAGTCAGGAGGG + Intronic
1034109386 7:148521579-148521601 CTGCTCTGCTTCTCTGAGGCGGG + Intergenic
1034298267 7:149993128-149993150 GTGCCCACCCACACTGAGGATGG + Intergenic
1034327241 7:150247886-150247908 GAGCTTTGACTCACAGAGGAAGG - Intronic
1034765969 7:153721571-153721593 GAGCTTTGACTCACAGAGGAAGG + Intergenic
1034807751 7:154103655-154103677 GTGCCCACCCACACTGAGGATGG - Intronic
1035409007 7:158623512-158623534 GTGGTGAGCCTCAGTGAGGAGGG - Intergenic
1039749625 8:40465112-40465134 GTTTACTTCCTCACTGAGGAAGG - Intergenic
1043459095 8:80441468-80441490 GTGCTGGCCCTCACTGAGGTGGG + Intergenic
1045831342 8:106464844-106464866 TTGTTCTGTATCACTGAGGATGG + Intronic
1046381193 8:113453146-113453168 GTGCCCACCCTCATTGAGGATGG - Intergenic
1047108606 8:121763198-121763220 GTGCAATGCCTGACAGAGGAAGG + Intergenic
1049211484 8:141388499-141388521 GAGCCCTGCCACACTGCGGAGGG + Intergenic
1049749890 8:144278076-144278098 GTGCGTGGCCTGACTGAGGAGGG + Intronic
1051636360 9:19184192-19184214 CTGGCCTGCCTCACTGAAGAAGG - Intergenic
1053147147 9:35719407-35719429 GTGCCTTGACTCACTGTGGAAGG - Intronic
1053646426 9:40122311-40122333 CTCCTCTGCCTCACTGGAGAGGG + Intergenic
1053759287 9:41341240-41341262 CTCCTCTGCCTCACTGGAGAGGG - Intergenic
1054327438 9:63720213-63720235 CTCCTCTGCCTCACTGGAGAGGG + Intergenic
1054538143 9:66253662-66253684 CTCCTCTGCCTCACTGGAGAGGG - Intergenic
1054813291 9:69451690-69451712 GTGCTGTGCTTCTCTGGGGATGG - Intronic
1055428279 9:76217955-76217977 GTGCTCCACCTCAATGAGGTGGG + Intronic
1055930884 9:81558877-81558899 GGGCTGTGCCTCACTGCAGAAGG - Intergenic
1056056947 9:82834549-82834571 ATGCTCTCCCTCACTCATGAAGG + Intergenic
1056180377 9:84076814-84076836 GTGCTCTACCTCACTGTGGCTGG - Intergenic
1057425455 9:94945613-94945635 GTGCTGTCCTCCACTGAGGAGGG + Intronic
1057767509 9:97934989-97935011 GTGTTGTGCCTCTCTGAGGAGGG + Intronic
1058950922 9:109903160-109903182 GTGCTCTTCCTCCCTGCGGCTGG - Intronic
1059642823 9:116234330-116234352 CTGTTCTGTCTCACTCAGGAAGG - Intronic
1059849384 9:118320345-118320367 GTTGTCTGCCTAACTGTGGAAGG - Intergenic
1061464038 9:130763816-130763838 GTGCCCTCCCTCACTGAATAGGG - Intronic
1061974162 9:134059999-134060021 GAGCTCTGTCTCCCAGAGGAGGG + Intronic
1062097124 9:134709290-134709312 GAGCTGTGCCTGGCTGAGGAGGG + Intronic
1062340750 9:136092996-136093018 GGGCTCTGCCCCACTGACGGTGG + Intronic
1062429338 9:136520045-136520067 GAGCTCTGCCCCAGGGAGGATGG - Intronic
1062687529 9:137822475-137822497 GAGCTCTCACTCACTGAGGTGGG - Intronic
1202794214 9_KI270719v1_random:105742-105764 CTCCTCTGCCTCACTGGAGAGGG + Intergenic
1203520409 Un_GL000213v1:40614-40636 GTGCTCTGGGTCACTGAAGAAGG - Intergenic
1186424933 X:9456460-9456482 GTGCTCACCCGCACTGAGGAGGG + Intergenic
1187725408 X:22197310-22197332 GTCCCCTGCCACACTGAGTAAGG + Intronic
1192310804 X:70012791-70012813 CTGCTATTCCTCACTGAGCAAGG + Intronic
1192964209 X:76159839-76159861 GTGCTCTGTCTCAGGGAGGTGGG - Intergenic
1197776848 X:130123839-130123861 GTGCTCTGCTTCATAGAGGATGG - Intergenic
1199442114 X:147880024-147880046 GTGCAATGCCTCACGCAGGAGGG - Intergenic
1201149100 Y:11085683-11085705 CTCCTCTGCCTCACTGGAGAGGG - Intergenic
1201496780 Y:14597318-14597340 GTCCTCTTCCACACTGTGGAAGG - Intronic
1201543232 Y:15132037-15132059 GTGCTCTGTCCCACGGAGGTAGG - Intergenic