ID: 1180117360

View in Genome Browser
Species Human (GRCh38)
Location 21:45719099-45719121
Sequence CCCCGAATTCAGCCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180117360_1180117365 15 Left 1180117360 21:45719099-45719121 CCCTGGCCTGGCTGAATTCGGGG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1180117365 21:45719137-45719159 GTGATTAGCTCAGCTGTATCTGG 0: 1
1: 0
2: 0
3: 1
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180117360 Original CRISPR CCCCGAATTCAGCCAGGCCA GGG (reversed) Intronic
900282802 1:1882087-1882109 CCATGAATTCAGCAAGGCCCTGG + Intronic
900741698 1:4334155-4334177 CCCAGGGTTCAGCCAAGCCAGGG + Intergenic
900905744 1:5556011-5556033 CCCCGCATTTTGCCTGGCCACGG + Intergenic
901455688 1:9361581-9361603 CCCCTACTTCCGCCCGGCCACGG - Intronic
904689246 1:32281590-32281612 CCCTGAATTCAGCCAAGACAGGG + Intronic
905274343 1:36807375-36807397 CCCTGAGATCAGCCAGGACAGGG - Intronic
906680533 1:47723048-47723070 CCCCTAGTACAGCCAGGCCCGGG - Intergenic
910938147 1:92504096-92504118 GCACGAATTCAGCCGGGCCGAGG + Intergenic
912462941 1:109849125-109849147 CCCAGACTTAAGCCATGCCAAGG + Intergenic
913506199 1:119518070-119518092 CCCAGAATTCTGGGAGGCCAAGG + Intergenic
914814020 1:151049779-151049801 CCCAGAATTCTGGAAGGCCAAGG - Intronic
914946359 1:152070361-152070383 GCCCGTATTCAGACAGCCCAAGG + Intergenic
916520350 1:165557932-165557954 CCCCCAAAGGAGCCAGGCCATGG - Intronic
917940035 1:179909684-179909706 CCCAGCATTCAGGGAGGCCAAGG - Intronic
921937813 1:220810832-220810854 CTCTGAAGTCAGCCAGGCCTGGG + Intronic
1064211591 10:13364558-13364580 CCCAGCATTCAGGGAGGCCAAGG - Intergenic
1065599047 10:27350087-27350109 CCAGGACCTCAGCCAGGCCACGG - Intergenic
1067994293 10:51253409-51253431 CCCCAAATTAAGCCAGGGAAGGG - Intronic
1072450765 10:95537866-95537888 CCCAGCATTCTGCAAGGCCAAGG + Intronic
1072902467 10:99420680-99420702 TCCGGAACTCAGCCAGGCCCAGG + Exonic
1074447557 10:113533077-113533099 CCCTGAATCCTGCAAGGCCAGGG + Intergenic
1074569065 10:114608112-114608134 CCCAGAATTCTGGGAGGCCAAGG + Intronic
1076056964 10:127383743-127383765 CCCTGTTTTCAGCCAGGCCAGGG - Intronic
1076915930 10:133423208-133423230 CCCCGAGCCCAGCCAGGCCTAGG + Exonic
1077177795 11:1198501-1198523 CCCCGGAGCCAGGCAGGCCAGGG - Intronic
1077339571 11:2020131-2020153 CCCAGAATTCTGGGAGGCCAAGG + Intergenic
1079454730 11:20626563-20626585 CCCCAAATGCAGCCAGGGCTGGG - Intronic
1083884607 11:65566250-65566272 CCACCAAATCAGCCAGCCCAGGG + Intergenic
1084040328 11:66539112-66539134 CCCCCAACTCACCCAGGCCAGGG + Exonic
1084860709 11:72016056-72016078 CTCCAACCTCAGCCAGGCCAAGG - Exonic
1086085074 11:82945532-82945554 CCCCGTACTCAGCCAGGCTCAGG - Intronic
1089692831 11:120197495-120197517 CCCCCAGTTCAGCCCGGCCTTGG + Intergenic
1090403473 11:126463486-126463508 CCCAGCACTTAGCCAGGCCAGGG - Intronic
1202822556 11_KI270721v1_random:75320-75342 CCCAGAATTCTGGGAGGCCAAGG + Intergenic
1091583875 12:1805136-1805158 CCCAGAGTTCAGGCAGCCCACGG - Intronic
1101293310 12:103394408-103394430 GCCAGAATGCATCCAGGCCATGG - Intronic
1102494104 12:113307420-113307442 CCCAGAGTTCAGGCAGGACATGG - Intronic
1104242735 12:127006365-127006387 CCCAGAATTGAGGCAGGACAAGG - Intergenic
1104990744 12:132622559-132622581 CCCCACAGCCAGCCAGGCCACGG + Intergenic
1111804312 13:93020584-93020606 CCCAGAATTCTGGGAGGCCAAGG + Intergenic
1113064584 13:106360299-106360321 CCCAGAATTCAGCCTGGTCCTGG + Intergenic
1113389188 13:109879611-109879633 CCCCGAATTTTGGGAGGCCAAGG + Intergenic
1113405057 13:110031352-110031374 CTCCAAATGCAGCCACGCCAGGG + Intergenic
1113766908 13:112887615-112887637 CCCAGAATTCTGCCAGGGCTGGG - Intergenic
1117279438 14:54223461-54223483 CCCCCAATTAACCCAGGCCCAGG + Intergenic
1118213517 14:63787691-63787713 CCCCCAACTCAGCCAGAGCAGGG - Intergenic
1118410070 14:65469803-65469825 CCCCGAGATCAGCCAGAGCAGGG - Intronic
1121277223 14:92676645-92676667 CCCCCAACTCAGCCACGCCACGG + Intronic
1131003555 15:88957225-88957247 CTAGGTATTCAGCCAGGCCATGG + Intergenic
1131036671 15:89226997-89227019 CCCCGCCTTCAGCCAGGCAGAGG - Intergenic
1137637169 16:49996613-49996635 CCCAGAACTTTGCCAGGCCAAGG + Intergenic
1138453409 16:57106881-57106903 CCAGGACATCAGCCAGGCCAGGG - Intronic
1139736180 16:68990742-68990764 CCCTGAGCTAAGCCAGGCCATGG - Intronic
1141557322 16:84844830-84844852 CCCTGACTGCAGCCAGGCCCTGG + Intronic
1143343774 17:6234356-6234378 CACCGATTTCAGCCAGGAAAGGG + Intergenic
1144635844 17:16908496-16908518 CTCAGACCTCAGCCAGGCCAAGG + Intergenic
1145121928 17:20267839-20267861 CTCAGACCTCAGCCAGGCCAGGG + Intronic
1145908263 17:28528129-28528151 CCCTGATCTCAGCCAAGCCAGGG + Intronic
1146056207 17:29582580-29582602 CCCCAAAGGCAGCCAGGTCAGGG - Intronic
1149599671 17:57885411-57885433 CCTGGAGTTCAACCAGGCCATGG - Exonic
1151703211 17:75754067-75754089 CCCCAGTTTCAGCCAGGCCCGGG + Intronic
1154281681 18:13008957-13008979 CCCAGCATTCTGGCAGGCCAAGG - Intronic
1154315514 18:13300562-13300584 CCCCGAAATAAGCCAGGAGAAGG - Intronic
1157196898 18:45626828-45626850 CTTCCCATTCAGCCAGGCCAGGG - Intronic
1161296815 19:3524311-3524333 TCCCGGATGCAGCCAGGCCGGGG + Intronic
1163351493 19:16778890-16778912 CCCAGAAGTCAGCAATGCCATGG - Intronic
1163490912 19:17616748-17616770 CCCCCGATCCAGCCAGCCCAAGG - Intronic
1163668226 19:18612940-18612962 CCCCGCGTTCCGCCCGGCCATGG + Exonic
1164146961 19:22518212-22518234 CCCCGACTCCAGCCCGGCCCCGG + Intronic
1164235296 19:23326575-23326597 CCCAGCATTTTGCCAGGCCAAGG - Intronic
1165456035 19:35911276-35911298 TCCCCACTTCAGCCAGGCCTGGG + Intergenic
925784096 2:7411812-7411834 CCCCAAATTCATACATGCCATGG + Intergenic
927150366 2:20192064-20192086 CCCAGGATTCTGCCAGGCCAGGG - Intergenic
927543253 2:23930766-23930788 CCCAGAATTTAGAGAGGCCAAGG + Intronic
929574579 2:43043688-43043710 CCCTGACTCCTGCCAGGCCATGG - Intergenic
929997582 2:46838460-46838482 CACAAAAATCAGCCAGGCCATGG - Intronic
944054614 2:195510377-195510399 CCCAGAACTCAGGGAGGCCAAGG - Intergenic
946737216 2:222765904-222765926 CCCAGAATTCTGGGAGGCCAAGG + Intergenic
948831083 2:240598570-240598592 CCCCGAGTGCAGCCAGGGAATGG - Intronic
1172034633 20:32002301-32002323 CCACCCATTCAGCCTGGCCAGGG - Exonic
1172968775 20:38858394-38858416 CCTTCAATGCAGCCAGGCCACGG - Intronic
1173569324 20:44066539-44066561 CCCCTGATTCAGCCAAGACAAGG + Intronic
1173829655 20:46073692-46073714 CCCCGATTTCCACCAGCCCAAGG - Intronic
1174328191 20:49796405-49796427 CCCAGAATTTTGCGAGGCCAAGG - Intergenic
1175800566 20:61798813-61798835 TCCCGAGTCCAGCCAGGACACGG + Intronic
1175939308 20:62530639-62530661 CCCCAGACCCAGCCAGGCCACGG - Intergenic
1179726440 21:43343880-43343902 CCCTGAGTTCACCCAGGCCTGGG - Intergenic
1180117360 21:45719099-45719121 CCCCGAATTCAGCCAGGCCAGGG - Intronic
1180149977 21:45942478-45942500 CCCCCAATGCACCCAGGCCCCGG + Intergenic
1183099210 22:35573654-35573676 CCCCGGATTCAGGCACGCCGTGG + Intergenic
1184697879 22:46150143-46150165 CCTCGAATTCAGCCCCGCCCCGG + Intergenic
1185175711 22:49325367-49325389 CCCAGATTTCAGCCAGGCTCTGG + Intergenic
1185279889 22:49965508-49965530 CCCCGGCTTCAGCCAGGCAAAGG + Intergenic
1185314031 22:50171062-50171084 CCGCGGACGCAGCCAGGCCACGG - Intronic
952342883 3:32460041-32460063 CCCAGAAGACAGCCAGGCCTGGG - Intronic
953678434 3:45021353-45021375 CACCGAATGCAGCCAGGGCAGGG - Intronic
954364151 3:50137493-50137515 GCCCGCATTCAGCCAGGCTGAGG + Intergenic
954746807 3:52792063-52792085 CCCCAAAATCAGCCAGCTCAGGG - Intronic
957947914 3:87088774-87088796 CCCCGAAGACTGCGAGGCCAGGG - Intergenic
965220677 3:165922662-165922684 CCCCAACTTCAGCCATGCTATGG + Intergenic
968679330 4:1905807-1905829 CCCCGAATTCTGGCAAGCCAAGG - Intronic
969131876 4:4996095-4996117 CCCCGAAGCCAGCCAGGCTGTGG - Intergenic
969409623 4:7019588-7019610 CTCCCACTTCAGCCAGGCCAGGG - Intronic
971714082 4:30153380-30153402 GCCCGAGCTCAGCCAGGGCAGGG - Intergenic
972457574 4:39269436-39269458 CCCTGAAGTCCACCAGGCCATGG - Intronic
977928707 4:102729341-102729363 CGCCAACTGCAGCCAGGCCAAGG - Intronic
980586751 4:134827824-134827846 CCCAGAATTCTGGGAGGCCAAGG + Intergenic
984424336 4:179563956-179563978 CCCCGCATTGAACCAGGTCAAGG - Intergenic
985042900 4:185910108-185910130 CCCAAATTCCAGCCAGGCCAAGG + Intronic
986370184 5:7072447-7072469 CCTTGAATTCAGCCTGACCATGG - Intergenic
987212372 5:15695792-15695814 CTCTGGATTCAGACAGGCCAGGG - Intronic
988146313 5:27313287-27313309 CCAGGAATTCAGGCAGGGCATGG - Intergenic
995049404 5:107685047-107685069 CCCAGAATTTTGGCAGGCCAAGG - Intergenic
997882657 5:137604182-137604204 AACCAAATTCTGCCAGGCCAGGG + Intergenic
999797662 5:155003382-155003404 CCCAGAATTCTGAGAGGCCAAGG - Intergenic
1001193829 5:169653923-169653945 CCCCTCCTTCAGCCAGGCCTGGG - Intronic
1001584392 5:172823532-172823554 CCCCGTGTCCAGCAAGGCCAGGG - Intergenic
1002183189 5:177441942-177441964 TGCCAAACTCAGCCAGGCCAGGG - Exonic
1002359394 5:178658738-178658760 TCCAGAATTTAGCCAGGACAGGG + Intergenic
1007430758 6:41775418-41775440 CGCCGATGTCAGACAGGCCAGGG - Exonic
1012197959 6:96368020-96368042 CCCAGAATTTAGGGAGGCCAAGG + Intergenic
1014743342 6:125171011-125171033 CCCCAAAATCAGCCAGCCCTTGG - Intronic
1017455687 6:154599173-154599195 GCCCCAGTTCAGCCAGGCCCAGG - Intergenic
1019577516 7:1744555-1744577 GCCCCAATTCAGCCTGCCCAGGG - Exonic
1020158011 7:5743010-5743032 CCCAGCATTCAGGGAGGCCAAGG + Intronic
1024259172 7:47560890-47560912 CCCCCACATCAGGCAGGCCATGG + Intronic
1025124985 7:56337324-56337346 CCCAGAATTTGGCGAGGCCAAGG + Intergenic
1033665544 7:143437372-143437394 CCTCCACTTCAGCCAGGCGAAGG - Intergenic
1035179340 7:157077997-157078019 CCCAGAACCCAGCCAGGCAAAGG - Intergenic
1037711828 8:21361086-21361108 CCCAGAATTGAGCAGGGCCAGGG + Intergenic
1038112298 8:24513166-24513188 CTCCCAATTCAGCCAGAGCATGG + Intronic
1042559564 8:70063181-70063203 CCCAGAATTTAGGGAGGCCAAGG + Intronic
1043430653 8:80191255-80191277 TCGCGAATTCAGCCAGGGCCAGG + Intronic
1045518999 8:102886954-102886976 CCCCTACTTCCTCCAGGCCAGGG + Intronic
1047922747 8:129652164-129652186 CCCCGAAAGCAGCCAGCCCAGGG + Intergenic
1048303349 8:133267086-133267108 CCCCGAAGCCAGCCAGCCCCAGG + Intronic
1049812493 8:144581763-144581785 CCCCCAGATCAGCAAGGCCAAGG + Intronic
1056777768 9:89526230-89526252 CCACGAAGTCAGCCAGTCCTGGG - Intergenic
1057964430 9:99489266-99489288 TCTGGAACTCAGCCAGGCCATGG + Intergenic
1060759655 9:126236454-126236476 CCCCCAGCTCAGCCAGGCCCGGG + Intergenic
1062275513 9:135728575-135728597 CCCAGAACTCAGGGAGGCCAAGG + Intronic
1187322942 X:18257635-18257657 CCCAGCATTCTGCGAGGCCAAGG + Intronic
1187327712 X:18307207-18307229 CCCGGAAGTCATCCAGGCCGCGG + Intronic
1188709833 X:33381817-33381839 TACAGAATTCAGCCAGGCAATGG + Intergenic
1193698503 X:84737950-84737972 CCCCGACTCCCTCCAGGCCAGGG + Intergenic
1196857262 X:119995885-119995907 TCCCCAATTCAGCCAGGCGCTGG + Intergenic
1198106848 X:133470130-133470152 CCCAGAATTCTGGGAGGCCAAGG - Intergenic
1198699464 X:139382134-139382156 CCCTGAACTCAGCCAGAGCAGGG - Intergenic