ID: 1180120131

View in Genome Browser
Species Human (GRCh38)
Location 21:45740304-45740326
Sequence GAAGTGACCTGCCAGTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180120131_1180120133 -10 Left 1180120131 21:45740304-45740326 CCGCCTCACTGGCAGGTCACTTC 0: 1
1: 1
2: 0
3: 14
4: 195
Right 1180120133 21:45740317-45740339 AGGTCACTTCTGTTAGCATCCGG 0: 1
1: 0
2: 0
3: 14
4: 138
1180120131_1180120134 -9 Left 1180120131 21:45740304-45740326 CCGCCTCACTGGCAGGTCACTTC 0: 1
1: 1
2: 0
3: 14
4: 195
Right 1180120134 21:45740318-45740340 GGTCACTTCTGTTAGCATCCGGG 0: 1
1: 0
2: 0
3: 21
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180120131 Original CRISPR GAAGTGACCTGCCAGTGAGG CGG (reversed) Intronic
900469896 1:2848554-2848576 TATGTGAGCTGCCAGTGTGGAGG + Intergenic
901366293 1:8752117-8752139 TAAGTAACTTGCCAGTGAAGTGG + Intronic
905292659 1:36933245-36933267 GAAGTCACTTGGCAGAGAGGTGG - Intronic
909802482 1:79828673-79828695 GAAGTGGACTGCCTGGGAGGGGG - Intergenic
910359874 1:86404940-86404962 GAAGAGACATGACAGTGGGGAGG - Intergenic
911259776 1:95671716-95671738 GAACTCAACTGCCAGTGAAGCGG - Intergenic
915020424 1:152774153-152774175 GAAGAGAACAGCCAATGAGGTGG - Intronic
915232319 1:154454866-154454888 GAACTGACCTGGCATTAAGGAGG + Intronic
916741193 1:167648676-167648698 GAAGTTACATACCAGTGATGGGG + Intronic
916887707 1:169086237-169086259 GGAGTGAGGTGGCAGTGAGGGGG + Intergenic
917667404 1:177238510-177238532 CAAGTGAGCTGACTGTGAGGAGG + Intronic
920573604 1:207038014-207038036 GAAGTGGAGTACCAGTGAGGAGG - Intronic
920732563 1:208501465-208501487 GAAGACAGCAGCCAGTGAGGAGG + Intergenic
922979695 1:229815156-229815178 GAAGGTACCTGCCTGCGAGGTGG + Intergenic
923125145 1:231028110-231028132 GAAGTGGCCTGGCAGTGGGGTGG + Intronic
924504421 1:244667837-244667859 GAGGTGACCAGCCAGTGAGAGGG + Intronic
1063121761 10:3109607-3109629 GAGGTGAGCTGCCCGTGGGGAGG + Intronic
1065421963 10:25554944-25554966 TCAGTGGCTTGCCAGTGAGGTGG - Intronic
1067028171 10:42861711-42861733 GAAGTGACTTGCAAATGTGGAGG - Intergenic
1070451581 10:76563687-76563709 GAAGTGACCCAACAGTGTGGTGG - Intergenic
1072097471 10:92196415-92196437 AAAGTGACATGCCAGTAAGTGGG - Intronic
1072229026 10:93398018-93398040 GAAGTGACATGAAAGTCAGGAGG - Intronic
1073433954 10:103504882-103504904 GAAGTGACCTGAAAATGAGTAGG + Intronic
1074858878 10:117494396-117494418 GATATGACCTGCCAGGGAGAGGG + Intergenic
1075730308 10:124631800-124631822 GAAGGAATCTGCCAGTGAAGAGG - Intronic
1076250350 10:128979776-128979798 GTAGGGACCTTCCAGTGATGGGG + Intergenic
1076261225 10:129068644-129068666 GAAGTGAATAGCCAGTGAGCTGG - Intergenic
1076291170 10:129346888-129346910 GAAATAACATCCCAGTGAGGGGG + Intergenic
1076840970 10:133044963-133044985 GCAGTGACCTGACAGTGTGAGGG - Intergenic
1078342422 11:10508161-10508183 AAATTGACCTGCCCGTGAAGAGG - Exonic
1078486895 11:11731559-11731581 CAAGTGAGCTGCTAATGAGGAGG + Intergenic
1079334841 11:19562249-19562271 GACGGCACCTGCCTGTGAGGTGG + Intronic
1081252318 11:40850815-40850837 GAGATGTCCTGCCAGAGAGGAGG + Intronic
1082838380 11:57668222-57668244 GAAGTGCCGTACCAGCGAGGTGG + Intronic
1083272112 11:61577846-61577868 GAGGTGACCTTGCAGTGAGCTGG - Intronic
1083530447 11:63417197-63417219 GAAGTGTGCTGCCAGTAAGGTGG + Intergenic
1083888519 11:65584396-65584418 GATGTGAGCTGCCAGAGGGGTGG + Exonic
1085040335 11:73323123-73323145 GAAGTGCCCTGCCTCTCAGGGGG + Intronic
1085793591 11:79517195-79517217 GAAGAGACCTGACAGTGAACCGG - Intergenic
1086530667 11:87781095-87781117 GAAGAGACCAGCCAGTCAAGTGG - Intergenic
1090829336 11:130410078-130410100 GAGGGGACCTGCCAGGGTGGTGG - Intronic
1092831546 12:12449037-12449059 GAAGTTACCTGCAAGGTAGGCGG - Intronic
1093342764 12:17998566-17998588 GAGCTGACCTGGCACTGAGGTGG - Intergenic
1094559039 12:31532458-31532480 GAAGAGACCAGGCAGGGAGGGGG + Intronic
1097189159 12:57211337-57211359 GATGTCACCTGCAAGTGAGTGGG + Exonic
1097972575 12:65650255-65650277 GAAGTGGCCTGCCACTCAAGAGG - Intergenic
1100896294 12:99186193-99186215 GAGATGCCCTGCCAGAGAGGAGG - Intronic
1104176019 12:126333375-126333397 GAGGTGAACAGCAAGTGAGGGGG + Intergenic
1104599094 12:130140332-130140354 GAAGGGAGGTGCCAGAGAGGCGG - Intergenic
1105925698 13:25005826-25005848 GGTGTGGCCTGCCAGTCAGGAGG + Intergenic
1106039000 13:26071789-26071811 GGTGTGGCCTGCCAGTCAGGAGG - Intergenic
1106344050 13:28858927-28858949 GAACTGAGCTGCCACTCAGGTGG + Intronic
1106791065 13:33155091-33155113 GAAGTCACCAGCATGTGAGGAGG - Intronic
1112078184 13:95936075-95936097 GAATTGACCTCCCAAAGAGGTGG + Intronic
1116049600 14:39787146-39787168 GATGTGGGCTGCCATTGAGGAGG + Intergenic
1116615703 14:47135667-47135689 GAAATGACCTTTCAGTGAAGGGG - Intronic
1117611532 14:57487926-57487948 GAAGTCAGCTCCCAGAGAGGAGG - Intronic
1120258682 14:82154283-82154305 GAAGTGAACTGCCAGGGAACTGG + Intergenic
1121518681 14:94570754-94570776 GAAATGGCCTGCCTGGGAGGAGG - Intronic
1121519367 14:94575574-94575596 GAAGTGGGCTGCCAGTGATGGGG + Intronic
1121615509 14:95311181-95311203 GAGGTGACCTGCCAATCTGGTGG - Intronic
1121999870 14:98638231-98638253 GAAGTCATCTGCCATAGAGGAGG - Intergenic
1122541624 14:102500992-102501014 GGAGTGACGGGACAGTGAGGAGG - Exonic
1123440760 15:20289467-20289489 GAAGTGAGCATCCAGAGAGGTGG + Intergenic
1124087924 15:26568989-26569011 GAAGGCACCTGCTAGTGTGGGGG - Intronic
1124954558 15:34351621-34351643 GAAGGGACCTAGCAATGAGGAGG + Intronic
1125099063 15:35889282-35889304 GCAGTGACCTGCCCTTGAAGTGG + Intergenic
1125406179 15:39354390-39354412 GAAGTGACCTGCCTGTGCAGAGG + Intergenic
1125506749 15:40271753-40271775 GAAGAGGCCTGGCAGTGGGGTGG - Intronic
1126297440 15:47156195-47156217 TAAGTCACCTGAGAGTGAGGTGG - Intergenic
1127075532 15:55321885-55321907 GAGGTGATCTGCCCGTGCGGTGG + Intronic
1127361250 15:58246859-58246881 GAAGTGATCTGCAAATGTGGAGG + Intronic
1128236366 15:66070290-66070312 GAAGTGAGCAGCCAGAGAGGTGG + Intronic
1128621759 15:69157211-69157233 GCAGTGAGCTGCCACGGAGGGGG - Intergenic
1128870011 15:71147618-71147640 CAAGAAACCTGCCACTGAGGAGG + Intronic
1129101675 15:73270736-73270758 GAAGTGACCTGCCCTTGACCAGG + Intronic
1132097592 15:98999277-98999299 GAAGAGACATGTCAGTGATGAGG + Intronic
1133867628 16:9658909-9658931 CAAGTAACCTACCAGTGTGGGGG + Intergenic
1137507175 16:49064284-49064306 GAGGTGACCTTCCAGGAAGGAGG - Intergenic
1140993125 16:80233604-80233626 CCAGTGACCTGCCACTGGGGAGG - Intergenic
1143407991 17:6690755-6690777 TAAGTAACCTGACAGTGGGGAGG - Intronic
1143646720 17:8235044-8235066 GAGCTGGCCTGCAAGTGAGGAGG - Exonic
1144003128 17:11074030-11074052 GAATTGTCCTGAGAGTGAGGAGG + Intergenic
1145400011 17:22524105-22524127 AAATTGACCTGCCCGTGAAGAGG + Exonic
1147125678 17:38366428-38366450 GAAGTGACCTGCCAGTCCTTAGG - Intronic
1147689459 17:42306503-42306525 GCAGTAACCTGTCTGTGAGGTGG - Intronic
1148358914 17:46995931-46995953 GCAGGGACCAGCCACTGAGGTGG - Intronic
1150431733 17:65123508-65123530 AAAGTGAACTCCCAGCGAGGAGG + Intergenic
1151883975 17:76912483-76912505 GAAATGACCTGCGTGGGAGGCGG + Intronic
1152424371 17:80210916-80210938 GGAGGGACCGGCCAGTGAGGTGG + Exonic
1157506552 18:48230663-48230685 GATGTGAGCTGCCAGTGGGTGGG + Intronic
1158342407 18:56480790-56480812 GAAGAGATCTGACAGTGAGGTGG - Intergenic
1160378858 18:78433844-78433866 GGAGGCACCTGCCAGTGACGAGG + Intergenic
1160922297 19:1526689-1526711 GAAGTTACCTGGCAGTGGGAGGG - Exonic
1161474219 19:4475250-4475272 GCAGTGAGAGGCCAGTGAGGGGG - Intronic
1162340864 19:10090981-10091003 GAAGTGAACTACTAGTCAGGAGG - Intronic
1162439298 19:10682755-10682777 CATGTGTCCTGTCAGTGAGGTGG + Intronic
925550193 2:5065295-5065317 GAAGTGACAAGTCAGTGACGAGG - Intergenic
926004856 2:9365792-9365814 GAAGTGAGCTGCCATAGAGCAGG + Intronic
929314531 2:40461485-40461507 GAACTGACTTGCAAGTAAGGAGG + Intronic
930331056 2:49984516-49984538 GAAGTGAGTGGCCAGTGAAGGGG + Intronic
930912665 2:56648216-56648238 GAAGTGACATAACAGTCAGGTGG - Intergenic
936370202 2:111897432-111897454 GAAGTGTCCAGCCAGTGTAGGGG + Intergenic
936797391 2:116224026-116224048 GGATTGACCTGCCAGTGGGGTGG - Intergenic
940446788 2:153786020-153786042 GGAGTGTTCAGCCAGTGAGGTGG - Intergenic
945941921 2:215959053-215959075 GAAGAGAGCTGAGAGTGAGGGGG - Intronic
946194087 2:218022854-218022876 GAAGTCACCTCCTGGTGAGGGGG + Intergenic
948776124 2:240289926-240289948 GAACTGACCGGCCAGTGGAGGGG + Intergenic
1171367171 20:24633301-24633323 GAAGGCACGTGCCAGAGAGGTGG - Intronic
1172125038 20:32620776-32620798 GAAGCTGCCTGCCTGTGAGGAGG + Intergenic
1172530895 20:35630733-35630755 GAGCTCACCTGCCAGTCAGGGGG + Exonic
1172808350 20:37629463-37629485 GAAGGGAGCAGCCATTGAGGGGG + Intergenic
1172842429 20:37909912-37909934 GAAGTGAGGTGGCAGTGGGGAGG + Intronic
1173545999 20:43898424-43898446 GAAGTGACCTGGGAGGTAGGAGG + Intergenic
1173821786 20:46024402-46024424 ACAGTGATCTGCCAGAGAGGAGG - Intronic
1175806745 20:61833872-61833894 AAAGTGAAGAGCCAGTGAGGAGG + Intronic
1176913058 21:14591454-14591476 GAAATCACCTTGCAGTGAGGGGG - Intergenic
1179145621 21:38765109-38765131 GTAGTCACCTCCCAGTGAAGAGG + Intergenic
1179937876 21:44616528-44616550 GAAGGCACCTGGCAGGGAGGAGG - Intronic
1180006955 21:45027276-45027298 GCAGGGACCAGGCAGTGAGGAGG + Intergenic
1180011718 21:45055493-45055515 GGAGGGACCGGCCAGTGTGGCGG + Intergenic
1180120131 21:45740304-45740326 GAAGTGACCTGCCAGTGAGGCGG - Intronic
1180308042 22:11145702-11145724 GAAGTGAGCATCCAGAGAGGTGG + Intergenic
1180546518 22:16507515-16507537 GAAGTGAGCATCCAGAGAGGTGG + Intergenic
1182212670 22:28689864-28689886 GAAGTGAGCATCCAGAGAGGTGG - Intronic
1182434166 22:30319704-30319726 GCATTGACTTGCCAGTGGGGTGG + Intronic
1182692673 22:32174985-32175007 GCAGTGACCTGCCAGAGAAACGG - Intergenic
1183182685 22:36271585-36271607 GAGATGCCCTGCCAGTGAGGAGG + Intergenic
1183725580 22:39587400-39587422 GAAGAGACCTGCCAGGCAGATGG - Intronic
1183782074 22:40005491-40005513 GTTGTGACCTGCCAGGGAGTAGG - Intronic
954803701 3:53202675-53202697 AAAGTGAGCTCTCAGTGAGGGGG + Intergenic
954876122 3:53804213-53804235 GAAGTGGAATGGCAGTGAGGTGG + Intronic
959486754 3:106935588-106935610 TAAGTGACTTGCCAAAGAGGAGG - Intergenic
959875717 3:111379990-111380012 GAACTGCCCTGCCAGTGAAGAGG - Intronic
960618293 3:119615905-119615927 GAAGTGACGTGGCAGAGAGTGGG + Intronic
961977545 3:131042565-131042587 GAGATGCCCTGCCAGAGAGGAGG - Intronic
962394149 3:135000084-135000106 GAAGTAAATTTCCAGTGAGGAGG - Intronic
963759241 3:149269869-149269891 GAAGGCATCTTCCAGTGAGGAGG + Intergenic
964183351 3:153913671-153913693 GAAGTTCCCGCCCAGTGAGGAGG - Intergenic
966152340 3:176878055-176878077 GAAGTGTTCAGCCAGTGGGGTGG - Intergenic
966895610 3:184442619-184442641 GAGTAGACCTGCCAGTGAGAAGG + Intronic
969531841 4:7734659-7734681 GCAGTGTCCTCCCTGTGAGGTGG - Intronic
969624558 4:8295695-8295717 TCAATGAACTGCCAGTGAGGGGG - Intronic
973543101 4:51953897-51953919 GAAGAGAACTGCCAGAGGGGTGG - Intergenic
976088416 4:81429871-81429893 TAAGTGGCCTGCCAGTGTGCTGG - Intronic
976396465 4:84560964-84560986 GAAGTGACATGCGAGAAAGGAGG - Intergenic
977649595 4:99454413-99454435 GGAGTTCCCAGCCAGTGAGGAGG + Intergenic
979393909 4:120162712-120162734 GAAGTGTCCTCCCATGGAGGAGG - Intergenic
980893207 4:138836774-138836796 AAAGGGACCTGCCACTTAGGAGG - Intergenic
981906520 4:149927431-149927453 GAAGCCAGCTGGCAGTGAGGAGG - Intergenic
982324582 4:154116849-154116871 GAAGTGACAGGCCAGTTAAGAGG - Intergenic
984507433 4:180637467-180637489 GAAGTGCTGTGCCAGTGAGGTGG + Intergenic
985018886 4:185666173-185666195 GAACTTACCTGCCAGTGTGTTGG - Intronic
986583167 5:9286558-9286580 GTAGTTTCCTGGCAGTGAGGTGG - Intronic
988101475 5:26684853-26684875 GAAATGACCTTCCAGTGATAAGG + Intergenic
989619017 5:43366833-43366855 GAGATGCCCTGCCAGAGAGGAGG + Intergenic
990116761 5:52400026-52400048 GAATTGACCCTCCAGTGAGTTGG - Intergenic
991161210 5:63505981-63506003 GAAGGGACCTGCAAGTGAATGGG - Intergenic
994094635 5:95838101-95838123 GCAGTGACATGGCAGTGGGGAGG + Intergenic
994488961 5:100417180-100417202 GGAGTGACATGGCAGTGATGTGG + Intergenic
995805198 5:116044273-116044295 GTATTAACCTGCCAGTGAAGTGG + Intronic
996095403 5:119393219-119393241 CATGTGACTTGGCAGTGAGGTGG - Exonic
997736866 5:136219394-136219416 GAAGTGCCCTGGAGGTGAGGAGG - Intronic
998417809 5:141958310-141958332 TAAGTGGCCTGCCGCTGAGGAGG + Exonic
999282409 5:150374335-150374357 GGAGTCATCTGACAGTGAGGAGG + Exonic
1001873980 5:175183300-175183322 GAAAGGAGCTGCCTGTGAGGTGG + Intergenic
1003304366 6:4913002-4913024 AGAGTGACTTGCCGGTGAGGTGG + Intronic
1003414082 6:5892653-5892675 GAAGAGAAGTGCCAGGGAGGAGG + Intergenic
1003429417 6:6025324-6025346 AAAGAGCCCAGCCAGTGAGGAGG + Intergenic
1004650567 6:17603564-17603586 AAAATGATCTGGCAGTGAGGAGG - Intronic
1006103542 6:31702160-31702182 GAAAGGACCTGCCAGTGGGCAGG - Intronic
1006519567 6:34563429-34563451 GAAGTGCCCAGGCAGTGATGGGG - Intergenic
1009267509 6:61574371-61574393 CAACTGACCTGCCCGTGAAGAGG + Exonic
1010635018 6:78248500-78248522 ACAGTGAACTGCCAATGAGGAGG - Intergenic
1011725216 6:90204164-90204186 GAAGTGCCCCGTCAGTGAGCTGG + Intronic
1019321342 7:416866-416888 GCAGTGACCTGCCACTGCGCTGG - Intergenic
1019849371 7:3538968-3538990 GAAGAGACATGCCAGTTTGGGGG - Intronic
1019923742 7:4179218-4179240 AAAGTCACCAGCCAGCGAGGAGG - Intronic
1021943141 7:25699558-25699580 TAAGTGAGCTGCAAGGGAGGTGG + Intergenic
1022887279 7:34659517-34659539 GAAGTGAACTTCCAGTAGGGAGG - Intronic
1024096934 7:45989482-45989504 CAGGTGACCTGCCAAAGAGGTGG + Intergenic
1025613677 7:63099948-63099970 GCAGGGACCTTCCAGTGAGAAGG + Intergenic
1026381373 7:69802992-69803014 GAAATGACCTCCAAATGAGGGGG - Intronic
1029413308 7:100428804-100428826 GAACTGACGGGCCAGTGAGCGGG + Intronic
1031365224 7:120892766-120892788 GAAGTACCTTGCCAGTGAGGGGG - Intergenic
1032202198 7:129829919-129829941 GGGGTTCCCTGCCAGTGAGGAGG + Intergenic
1033574490 7:142667274-142667296 AAACTGACCTGCCTGTGAAGAGG + Exonic
1035046827 7:155973294-155973316 GGTGAGGCCTGCCAGTGAGGTGG - Intergenic
1036809463 8:11857675-11857697 GAAGTCGCCTGCTAGTGAAGTGG - Intronic
1044738700 8:95304099-95304121 GTAGTAACCTGCCACTGAGGCGG + Intergenic
1045855776 8:106763730-106763752 GAGGTGTCCTGCCAGAGAAGAGG + Intronic
1050925411 9:11257493-11257515 GAAAGGACGTGCCTGTGAGGTGG + Intergenic
1052999732 9:34571361-34571383 GCAGTGGCCTGGCACTGAGGCGG - Intronic
1053121236 9:35548592-35548614 GCAGGGACCTGTCAGGGAGGTGG - Intronic
1054810523 9:69430436-69430458 GAAGGGGCCTTCCAGAGAGGTGG + Exonic
1055277926 9:74640756-74640778 GCACATACCTGCCAGTGAGGGGG + Intronic
1057445241 9:95109611-95109633 GATGTGTCCTGCCTGTGAGAAGG - Intronic
1059660007 9:116391357-116391379 GAAGTGACCTGCCAGTGATGTGG + Intronic
1060751683 9:126173805-126173827 GGAGTGAGCAGCCAGGGAGGAGG - Intergenic
1061078495 9:128355911-128355933 AAAGTGACCTGCCTGTGTAGAGG + Intronic
1061496435 9:130977552-130977574 GAAGAGTGCTGCGAGTGAGGTGG + Intergenic
1202629196 M:2676-2698 AAATTGACCTGCCCGTGAAGAGG + Intergenic
1187048728 X:15675344-15675366 GTAGTGACCGGCAAGGGAGGTGG + Intergenic
1190456416 X:50632420-50632442 GAAGTAATCTGGCAGTGAGTAGG + Intronic
1190598253 X:52067065-52067087 GACGGGACCTGGCAGGGAGGTGG - Exonic
1190610571 X:52187008-52187030 GACGGGACCTGGCAGGGAGGTGG + Exonic
1191809767 X:65174563-65174585 GAGATGCCCTGCCAGCGAGGAGG + Intergenic
1199606041 X:149580386-149580408 GGAATGAAGTGCCAGTGAGGAGG + Intergenic
1199633080 X:149788982-149789004 GGAATGAAGTGCCAGTGAGGAGG - Intergenic
1199711105 X:150470305-150470327 GAAGTGACATGCCAGTAACTTGG - Exonic
1201900501 Y:19043028-19043050 GGAGGGACTTCCCAGTGAGGAGG - Intergenic