ID: 1180122039

View in Genome Browser
Species Human (GRCh38)
Location 21:45759677-45759699
Sequence TTGGTTTTCCAGAAAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 943
Summary {0: 1, 1: 0, 2: 8, 3: 83, 4: 851}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180122039 Original CRISPR TTGGTTTTCCAGAAAGAGAA GGG Intronic
900375042 1:2350390-2350412 TTAGGCCTCCAGAAAGAGAAAGG + Intronic
902141434 1:14360056-14360078 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
902778787 1:18691489-18691511 TTGTTTTTCCCTAAAGGGAAAGG + Intronic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903006749 1:20303716-20303738 TTTGCTTTTCAGAAAGAGATTGG - Intronic
904449615 1:30602368-30602390 TTGGTTTTCCTGGGAGAGGAGGG + Intergenic
904639096 1:31908950-31908972 TTGTATTTTCAGAAAAAGAAGGG - Exonic
905049030 1:35032821-35032843 TAGGTTTTATAGACAGAGAAGGG + Intergenic
905214750 1:36398944-36398966 TTGGTTTTACAGCCAGAAAAGGG - Intergenic
905232631 1:36524003-36524025 CTGGCTTTCCTGGAAGAGAATGG + Intergenic
905649598 1:39647421-39647443 TGAGTTTTCCAGACAGAGAAAGG - Intergenic
906263608 1:44411801-44411823 TTGATTTTCCTGAATGAAAATGG + Intronic
906739808 1:48171930-48171952 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
907027235 1:51132618-51132640 TTGGTATCCCTGAAAGAGATGGG + Intronic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
907627706 1:56046807-56046829 TTGGTATAGCAGAAAGGGAATGG - Intergenic
907769143 1:57442671-57442693 TATGTTTTCCGGAGAGAGAAAGG + Intronic
907958266 1:59252322-59252344 TTGGTTTACCTGAAAGTGACGGG + Intergenic
907974469 1:59418078-59418100 TTGGTACTCCAGAAAGAGTGAGG + Intronic
908059170 1:60327975-60327997 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
908293308 1:62688689-62688711 TTGGCTTTCCCGAAATGGAAGGG + Intergenic
908515020 1:64883607-64883629 TTTGGTTTCCAGGAAGGGAAGGG - Intronic
908818690 1:68059743-68059765 TTGGTGTCCCTGAAAGAGAGGGG + Intergenic
909124374 1:71647218-71647240 TTGGTTCTCAAGAATGAAAATGG - Intronic
909264282 1:73536730-73536752 TTGGCATTCCTGAAAGAGAAGGG - Intergenic
909469850 1:76014563-76014585 TTGGTTTTCCAGATGGTGGAGGG - Intergenic
909552410 1:76913536-76913558 TTGGTTTACCTGAAAGTGACGGG - Intronic
909795120 1:79724943-79724965 TTGGAGTTCCAGAAATAAAAAGG + Intergenic
909835761 1:80252436-80252458 TTAGTTTCTCAGAAAGATAAGGG - Intergenic
909943884 1:81641040-81641062 TTGGCTTTATAGATAGAGAAGGG - Intronic
909983720 1:82135537-82135559 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
910158801 1:84251718-84251740 TTGGTTTTCAAGATGGAGGAAGG + Intergenic
910333597 1:86103999-86104021 TTGGTATTGCTGAAAGAGATGGG - Intronic
910651426 1:89572460-89572482 TTGGTTTACCTGAAAGAGATGGG - Intronic
910709903 1:90168351-90168373 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
911310577 1:96287945-96287967 TTGGTATCTCTGAAAGAGAAGGG - Intergenic
911525662 1:98982556-98982578 TTGGTTTTATGGAAAGAAAAGGG - Intronic
911595990 1:99799499-99799521 TTGGTGTTCCTGAAAGTGACGGG - Intergenic
911979684 1:104551539-104551561 TTGGTTTCCCTGAAAGACATGGG + Intergenic
912133197 1:106627378-106627400 TTGGTGTTCCTGAAAGTGACGGG - Intergenic
912887460 1:113489914-113489936 TTGGTGTTCCTGAAAGAGATGGG + Intronic
913077635 1:115354276-115354298 CTGTTTTCCCAGTAAGAGAAAGG - Intergenic
913349734 1:117843997-117844019 CTGGTGTTCCTGAAAGAGACGGG + Intergenic
913718645 1:121566952-121566974 TACATTCTCCAGAAAGAGAAGGG - Intergenic
914216090 1:145629971-145629993 TTGGCATTGCAGAAAAAGAATGG - Intronic
914468659 1:147952626-147952648 TTGGCATTGCAGAAAAAGAATGG - Intronic
915052078 1:153085556-153085578 TTGGTGTTGCTGAAAGAGAAGGG + Intergenic
915053684 1:153104561-153104583 TTGGTGTTGCTGAAAGAGATGGG + Intronic
915380051 1:155432290-155432312 TTAGTTTCCCAGAAAAAGTAAGG - Intronic
915444285 1:155966077-155966099 TTGGTGTAACAGAAAGAGCATGG - Intronic
915699826 1:157781272-157781294 TGGGTTTTCCAGAAGGTGGATGG + Intergenic
915807131 1:158865833-158865855 TTGGTGTACCAGAAAGTGATGGG + Intergenic
915828535 1:159103816-159103838 GTGATTTGTCAGAAAGAGAAAGG - Intronic
916596682 1:166250691-166250713 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
917567148 1:176224635-176224657 TTGGTTTTATAGACAGAGAAGGG - Intergenic
917690409 1:177462585-177462607 TAGGTTTTACAGATGGAGAAAGG + Intergenic
917770650 1:178273857-178273879 GTGGTTTTTCATAAAAAGAAAGG + Intronic
918407813 1:184227687-184227709 GTGGTGTTCGAGAAACAGAACGG - Intergenic
918630353 1:186710022-186710044 TTGGATTTCCAGAGATAGCAAGG - Intergenic
918655051 1:187014723-187014745 TTAGTTGACCAGATAGAGAATGG - Intergenic
918910308 1:190559310-190559332 TTGGTTTTGGAGAAGGAGGATGG - Intergenic
918939454 1:190972868-190972890 TCTGTTTTCCACAAACAGAAGGG + Intergenic
919172397 1:193971683-193971705 TTACTTTTCCACAAAAAGAATGG + Intergenic
919213090 1:194513390-194513412 TTGGTTTTTAAAAAAAAGAAAGG + Intergenic
920107397 1:203563632-203563654 CTGGTCTTCCAGGAGGAGAAGGG - Intergenic
920310216 1:205044136-205044158 TTGGCTTTCCAGTAAGGAAAGGG + Intronic
920699756 1:208208998-208209020 TTGCTTTTCCAAAATGGGAAGGG - Intronic
920993519 1:210963816-210963838 TTGGTGTACCAGAAAGTGACTGG + Intronic
921404417 1:214763753-214763775 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
922170457 1:223150192-223150214 TTGCTTTGGCAAAAAGAGAAAGG - Intergenic
922397404 1:225216512-225216534 TTGGTGTACCAGAAAGTGACTGG - Intronic
923026795 1:230210901-230210923 TTGTTCTTCCAGAATAAGAATGG - Intronic
923061088 1:230475246-230475268 TTGGTGTACCAGAAAGTGACAGG - Intergenic
923379343 1:233399727-233399749 TTGGCTTACCAGAATGAAAAAGG + Intergenic
923711299 1:236389383-236389405 TTGGTTTCCCACAAACAGAATGG - Intronic
923812953 1:237340955-237340977 TTGTCTTTCTAGAAACAGAAAGG - Intronic
924012411 1:239680059-239680081 ATGTTTTTACACAAAGAGAAGGG - Intronic
924095292 1:240544766-240544788 TTGGCTTTGTAGATAGAGAAAGG - Intronic
924331870 1:242947689-242947711 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
924874919 1:248092187-248092209 GGGGTTTTCCAGATATAGAATGG + Intronic
1062965201 10:1601907-1601929 CTGGGTTTCCACAAAGGGAATGG - Intronic
1063237128 10:4128630-4128652 TTGGCTTTACAGATAGAAAAAGG + Intergenic
1063257354 10:4342875-4342897 TTGGTTTCTCAGAAAGCTAAAGG + Intergenic
1064493302 10:15883171-15883193 TGGGTTTTCTAGAAAGAGGCTGG + Intergenic
1064759038 10:18599949-18599971 TTGGTTTTCCAAAATCAAAAAGG - Intronic
1064761816 10:18628778-18628800 TTGGTGTACCAGAAAGTGACGGG + Intronic
1065404366 10:25347248-25347270 CTGGCTTTGAAGAAAGAGAAAGG - Intronic
1066073469 10:31846822-31846844 TTGGAGTTCCAGAAGGAGAAAGG - Intronic
1066095959 10:32072274-32072296 TGGTCTTTCCATAAAGAGAAGGG - Intergenic
1066176596 10:32913690-32913712 TTGGTGTACCAGAAAGTGACAGG + Intronic
1066182590 10:32977713-32977735 TTTGTTTTTTAGAAATAGAATGG - Intronic
1066579844 10:36868301-36868323 CTAGTTTTCCAGGAATAGAAGGG - Intergenic
1066595833 10:37049127-37049149 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1067113613 10:43418282-43418304 TGGTTTTTGCAGGAAGAGAAGGG - Intergenic
1067282761 10:44885277-44885299 TTGGTTTTGTAGACAGAGAAAGG + Intergenic
1067333523 10:45342987-45343009 TTGGTGTACCTGAAAGAGACGGG + Intergenic
1067974470 10:51008441-51008463 TAGGGTTTTCAGAAAGAGCATGG - Intronic
1068085937 10:52373843-52373865 TTGGTATACCTGAAAGTGAAGGG - Intergenic
1068490484 10:57717597-57717619 TTGGTGTACCAGAAAGTGACAGG + Intergenic
1068495480 10:57780367-57780389 TTGGTGTACCAGAAAGTGACGGG + Intergenic
1068572538 10:58646027-58646049 TTGCTATTCCAGAAAAACAAGGG - Intronic
1069072148 10:63999853-63999875 TTGGTGTTCCTGAAAGAGATGGG + Intergenic
1069590509 10:69638813-69638835 TTGTTTTTCCAGAATGAGGGAGG - Intergenic
1069968083 10:72138390-72138412 CTAGTTTTCCAGAAAGACAAAGG - Intronic
1070061831 10:72991074-72991096 TTGGTATACCAGAAAGTGATGGG + Intergenic
1070380357 10:75875738-75875760 TTCTTTTTAAAGAAAGAGAAAGG + Intronic
1070572155 10:77648386-77648408 TTGGTTTTCCAGGAAGATAGTGG - Intergenic
1070668509 10:78362092-78362114 TGGGTTTTCCAGGATGGGAAGGG + Intergenic
1070729732 10:78818251-78818273 TTGCTTGTCCAGCATGAGAAGGG - Intergenic
1071134412 10:82437152-82437174 TTGGAGTACCAGAAGGAGAAGGG - Intronic
1071349791 10:84728659-84728681 TTGGTATACCTGAAAGAGATGGG + Intergenic
1071740672 10:88354831-88354853 TTGGTGTACCCGAAAGTGAAGGG - Intronic
1071836714 10:89425456-89425478 TCTGTTTTTCAGAAAGAAAAAGG + Intergenic
1072014873 10:91336850-91336872 TTTGGTTTCCTGCAAGAGAAAGG - Intergenic
1072374370 10:94799613-94799635 TTGGTGTACCAGAAAGTGATAGG - Intronic
1073070873 10:100792478-100792500 TGGAGTTCCCAGAAAGAGAAGGG - Intronic
1073496054 10:103892149-103892171 CTTGTTTTCCAGAAAGATGATGG - Exonic
1074228177 10:111507874-111507896 TTGGTATTCCAGCATGGGAAGGG + Intergenic
1074578684 10:114695483-114695505 TTGAATTTGTAGAAAGAGAATGG - Intergenic
1075118912 10:119650471-119650493 TTGGTTTTATAGACAGAGAAGGG - Intergenic
1075478953 10:122762894-122762916 CTGGTTTTCCAGCAGCAGAATGG + Intergenic
1075858182 10:125649030-125649052 TTGGTGTACCTGAAAGAGACAGG + Intronic
1075923959 10:126235757-126235779 TTGGTTTCCAAGAAAAATAATGG + Intronic
1076514460 10:131036040-131036062 CTGGTTCCCCAGCAAGAGAAAGG - Intergenic
1076672137 10:132128504-132128526 TTGGAATCCCAGAAAGAGAAAGG - Intronic
1077702005 11:4450977-4450999 TATGTTTTCAAGAATGAGAATGG + Intergenic
1077982484 11:7314677-7314699 TTGGCATTCCAGAAATAGAAAGG + Intronic
1078121784 11:8517864-8517886 TTGGTGTACCTGAAAGTGAAGGG + Intronic
1078560546 11:12367466-12367488 TTGGTGTACCAGAAAGTGATGGG + Intergenic
1078673191 11:13383295-13383317 GTCTTTTTCCAGAAAGAGAGGGG + Intronic
1078690133 11:13571349-13571371 TTGGTGTACCTGAAAGAGATGGG + Intergenic
1078973127 11:16438452-16438474 TTTCTTTCCTAGAAAGAGAATGG + Intronic
1079478388 11:20855915-20855937 TTAGTTTTCCAGATAGATCAGGG + Intronic
1079810471 11:24993156-24993178 GTAGTTTTCCAGACAGATAATGG - Intronic
1079866731 11:25745501-25745523 TTGGTTTTATCAAAAGAGAAAGG + Intergenic
1080075450 11:28142235-28142257 TTGGTTTTATAGATAGAAAAGGG + Intronic
1080783421 11:35452398-35452420 TTGGCATCCAAGAAAGAGAAGGG + Intronic
1080954884 11:37081846-37081868 CTGGTGTTCCAGCAACAGAAAGG + Intergenic
1081026478 11:38020710-38020732 TTGGTGTTCCTGAAAGAGATGGG + Intergenic
1081340489 11:41921519-41921541 CTGGGTCTCCAGAAAGGGAAAGG - Intergenic
1081348597 11:42020860-42020882 TTAGTTTGCCAGAATGGGAAAGG + Intergenic
1081454255 11:43205848-43205870 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
1081458177 11:43245985-43246007 TTGGTTATAAAGAAAGACAAAGG + Intergenic
1081768382 11:45629108-45629130 TTGGTTTACCTGAAAGTGATGGG + Intergenic
1081823045 11:46019055-46019077 TTAGGCTTCCAGAATGAGAAAGG - Intronic
1081985909 11:47304037-47304059 TTGGATTTCCAAAGAGAGAAGGG - Intronic
1082134528 11:48532524-48532546 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1082136362 11:48554001-48554023 TTGGTTTACCTGAAAGTGATGGG - Intergenic
1082599717 11:55134218-55134240 TTGGTGTACCAGAAAGTGATGGG + Intergenic
1082615881 11:55358422-55358444 TTGGTGTCCCTGAAAGAGATAGG + Intergenic
1083001157 11:59292197-59292219 TTAGTTTTCCAGGAAGAGGGTGG + Intergenic
1085434027 11:76482776-76482798 TTGGTTTACCTGAAAGTGACAGG + Intronic
1085644958 11:78216914-78216936 TTGGTGTTCCAATAAGTGAATGG - Exonic
1086081619 11:82908903-82908925 TCAGTTTTACAGAAAGAGAAGGG - Intronic
1086301117 11:85427150-85427172 TTGGTGTACCTGAAAGTGAAAGG + Intronic
1086613328 11:88783635-88783657 TTCATTTTCCAGAGAGAGAGAGG - Intronic
1086662728 11:89441346-89441368 TTGGTTTTCCAGAAGGTAGAAGG - Intronic
1087374503 11:97324995-97325017 TTGGTGTACCTGAAAGAGATGGG - Intergenic
1087552279 11:99666504-99666526 TTGGTTTCCCAGACATAAAAAGG - Intronic
1087626872 11:100605291-100605313 TTGGGGTACCAGAAAGAGACAGG + Intergenic
1087718981 11:101640409-101640431 TTGGTGTTCCTGAAAGTGACAGG + Intronic
1088281738 11:108141679-108141701 ACAGTTTTCCAGAAAGAAAATGG + Exonic
1088610348 11:111570619-111570641 TTTGTTTTCCAGAAAGAAACTGG + Intergenic
1088858250 11:113775944-113775966 TTGGTTTTATAGAAAGAAAAAGG - Intergenic
1088919318 11:114249959-114249981 ATGGGTGTCTAGAAAGAGAAAGG - Intronic
1088976321 11:114819554-114819576 TTGGCATTCTGGAAAGAGAATGG - Intergenic
1089273805 11:117319762-117319784 TTGGTTTTGCTTAAAGAGATGGG - Intronic
1089283301 11:117389693-117389715 TGGGTTTGCCAGATAGAAAAGGG + Intronic
1089474822 11:118750811-118750833 TAGGTTTACCAGAGAGAGCAAGG - Exonic
1089654767 11:119939292-119939314 TTGGCTTTTTGGAAAGAGAATGG - Intergenic
1090057932 11:123439267-123439289 TGGGTTTTCCAGTGGGAGAAGGG + Intergenic
1090065085 11:123496552-123496574 TTGGCCTTACAGAAAGAGATAGG - Intergenic
1090170356 11:124596988-124597010 TAAGGATTCCAGAAAGAGAAAGG - Intergenic
1090232959 11:125122811-125122833 TTCATTGTGCAGAAAGAGAAAGG + Intergenic
1090442097 11:126732828-126732850 TTGGTTTTCTGGTAAGATAAGGG - Intronic
1091786108 12:3244303-3244325 TTGGAGGTCCAGAAAAAGAAGGG - Intronic
1092146399 12:6217704-6217726 TTGCTTTTCCAGGAGGACAATGG + Intronic
1092178886 12:6431115-6431137 TTCTTTTTGCAGATAGAGAAAGG - Intergenic
1092718606 12:11417674-11417696 TTGGTATACCTGAAAGTGAAGGG + Intronic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093368445 12:18333930-18333952 TTGGTTTTCCAGAAAGATGCAGG + Intronic
1093621768 12:21299397-21299419 GTGGTTTTCCAGCAAATGAAAGG - Intronic
1093940809 12:25051839-25051861 TAGCTTTTACAGAAAAAGAAAGG - Intronic
1094226755 12:28054588-28054610 TTTGTTTTCCTGTAAGAGCAGGG + Intergenic
1094734675 12:33221669-33221691 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
1094776236 12:33731213-33731235 TTGGAGTACCAGAAAGAGACAGG - Intergenic
1094789204 12:33891241-33891263 TTGGTTTCCCATAAGGAGAAAGG + Intergenic
1095600191 12:44004444-44004466 ATGGATTTACACAAAGAGAATGG + Intronic
1095653782 12:44645465-44645487 TTGGGTGTCCAGAATGAGAGAGG + Intronic
1096029764 12:48402859-48402881 TTGGTGTACCAGAAAGTGATGGG - Intergenic
1096464406 12:51840356-51840378 TAGGTTTTCCAGACTGCGAAAGG - Intergenic
1096838194 12:54364668-54364690 TTGGGTTTCAGGAAGGAGAAAGG - Intergenic
1097890677 12:64774316-64774338 TTGGTGTACCTGAAAGAGATGGG + Intergenic
1098255088 12:68608668-68608690 TTTTTTTTCCAGAAAGAAATTGG - Intergenic
1098422937 12:70323061-70323083 TTGGTTCTCCTCAAGGAGAATGG - Intronic
1098693791 12:73525780-73525802 TTGTTTTTCCTGAATGATAATGG - Intergenic
1099032576 12:77546209-77546231 TGGGCTTTCCAAAAATAGAAAGG - Intergenic
1099061985 12:77922741-77922763 TTGGTCTTCTAGAAAAACAAAGG - Intronic
1099261415 12:80387346-80387368 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1099347265 12:81517840-81517862 TATGTTTTCAGGAAAGAGAAAGG - Intronic
1099732580 12:86524683-86524705 TTGGTGTCCCTGAAAAAGAAGGG - Intronic
1099841640 12:87974381-87974403 TTGGTATACCTGAAAGAGACGGG - Intergenic
1099897687 12:88668979-88669001 TTGGTTTACCTGAAAGTGACAGG + Intergenic
1100075397 12:90775028-90775050 TTGGTTTTATAGACAGAAAAGGG + Intergenic
1100654613 12:96628445-96628467 ATGTTCTTCCAGAAAGAGATGGG - Intronic
1100772348 12:97937359-97937381 TTGGTGTCCCAGTAATAGAAAGG - Intergenic
1100900932 12:99239442-99239464 TTGGTGTACCAGAAAGTGACAGG + Intronic
1100945743 12:99782087-99782109 TTTTTTTTCCAGACAGAAAAGGG - Exonic
1101817409 12:108156179-108156201 TTGGTTCTTCACGAAGAGAAAGG + Intronic
1102139432 12:110602485-110602507 TTAATTCTCCAGAAAGCGAAAGG - Intergenic
1103026570 12:117578980-117579002 TTTGTTTTTCAGAAATAGATTGG - Intronic
1103474423 12:121208295-121208317 TTGTTTTTCCAAATATAGAAAGG - Intergenic
1104061334 12:125270954-125270976 TTTTTTTTCCCGAAAGAGATAGG + Intronic
1104202683 12:126606843-126606865 TTGGTTCACCTGAAAGAGAATGG - Intergenic
1106425651 13:29626293-29626315 CTGGTGTTCCTGAAAGGGAAGGG + Intergenic
1106587596 13:31070789-31070811 TCGGTTTTCCAGAAAGATAATGG + Intergenic
1106651009 13:31689871-31689893 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
1106706302 13:32283464-32283486 TTGAGTTTCCAAAAAGAAAACGG + Intronic
1106895130 13:34291763-34291785 TTAGTTATCCAGGTAGAGAATGG + Intergenic
1107223165 13:38011020-38011042 TTTGTTTTACAGAAAGACATTGG - Intergenic
1107258187 13:38456159-38456181 TTGGAGTTCCAGAAAGAAAGAGG - Intergenic
1107642413 13:42457077-42457099 TTAGTAATCCAGAAAGATAAGGG + Intergenic
1107647703 13:42512463-42512485 TTCGTAATCCAGAAAGATAAGGG - Intergenic
1107856975 13:44625731-44625753 TAAAGTTTCCAGAAAGAGAATGG - Intergenic
1108188213 13:47909485-47909507 TTGGTGTTCCTGAAAGTGACGGG + Intergenic
1108209204 13:48121284-48121306 GTGGTTTTCCAGAGAAGGAAAGG + Intergenic
1108497947 13:51043569-51043591 TTGTTATTCCAGAATGAGAATGG - Intergenic
1108582141 13:51836860-51836882 TGGATTTTCCAGAGTGAGAAGGG + Intergenic
1108675949 13:52738500-52738522 TTTGTTTTCCAGAGAGAGAAGGG + Intronic
1109328795 13:60901855-60901877 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1109554211 13:63950166-63950188 TTGGTTTTCAAGACAGAGAAGGG + Intergenic
1109719452 13:66258381-66258403 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1109830986 13:67788382-67788404 TTGGTTTTCCAGTAAGATTTTGG - Intergenic
1109899174 13:68741141-68741163 TCAGTTTTCCAAAAAAAGAAGGG - Intergenic
1110375843 13:74793206-74793228 TTGGTGTTCCTGAGGGAGAAGGG - Intergenic
1110804035 13:79734603-79734625 TTGGTGTCCCTGAAAGAGACAGG - Intergenic
1110872164 13:80465015-80465037 TTGGTCATTCAGGAAGAGAATGG + Intergenic
1110877133 13:80523788-80523810 TTGGCTTTGCAGAATGAGTAAGG + Intergenic
1111032604 13:82624196-82624218 TTGGTTTGCCAAAATAAGAAAGG + Intergenic
1111055555 13:82944966-82944988 TTGGCATTCCAGAGAGAGAAGGG + Intergenic
1111181022 13:84665198-84665220 TTGGTTGAAAAGAAAGAGAAGGG + Intergenic
1111482355 13:88846873-88846895 TTGGTTTTCCATTATGAAAAAGG + Intergenic
1111720066 13:91932163-91932185 TTGTATTTTCAGAAAGAGACTGG + Intronic
1112110898 13:96297501-96297523 TTGGTGTTCCAGGAACAGCAGGG + Intronic
1114230289 14:20775315-20775337 TTTCTTCACCAGAAAGAGAAAGG - Intergenic
1114573076 14:23688937-23688959 TTGGTGTTCCTGAAAGTGACGGG - Intergenic
1115576347 14:34715033-34715055 GTGGTTTTCCCGAAAGAGGCTGG + Intergenic
1115815122 14:37154940-37154962 TTGGTTTTCGAAAAAGATATCGG - Intronic
1115931594 14:38502977-38502999 TTGGTATTCAGGAAAGAGCATGG - Intergenic
1115954761 14:38765542-38765564 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1116074281 14:40090028-40090050 TTGGTTTACCTGAAAGTGACGGG + Intergenic
1116212599 14:41967428-41967450 TTGGTGTACCAGAAAGAGACGGG - Intergenic
1116719796 14:48481864-48481886 TTGGTGTACCAGAAAGTGACGGG + Intergenic
1116730605 14:48616820-48616842 TTCATTTTTAAGAAAGAGAATGG + Intergenic
1117005539 14:51417768-51417790 TTGGTTTACCTGAAAGCGACAGG - Intergenic
1117121230 14:52569817-52569839 TTGGTGTGCCTGAAAGTGAAGGG + Intronic
1117172924 14:53118686-53118708 TTGGTGTACCAGAAAGTGACCGG + Intronic
1117334208 14:54743020-54743042 CTGCTTCTCCAGAATGAGAATGG + Intronic
1117386394 14:55218038-55218060 TTTTTTTTCCTGAAAGACAAAGG - Intergenic
1117638903 14:57776173-57776195 CTGGTGTTCCTGAAAGAGATGGG + Intronic
1117821371 14:59652959-59652981 TAGGAGTTCCAGAAAGAGAGAGG + Intronic
1118317392 14:64733540-64733562 TTGGTATTCCAGAGAGGCAAAGG - Intronic
1118502301 14:66373166-66373188 TGGGTTTTTTAGAAAGAGAAGGG - Intergenic
1119418300 14:74490928-74490950 TTGGGTTTCCAAAAAAAGAAGGG - Intronic
1119930434 14:78541231-78541253 TTGGTTTCCCTGAAAGTGATGGG - Intronic
1119957057 14:78809736-78809758 TTGATTTTAGAAAAAGAGAAAGG + Intronic
1120107889 14:80516978-80517000 TTGGTTTTCCTGAGAGATAGGGG + Intronic
1120139144 14:80908286-80908308 TTGCATTTCCAGAAGGAGAGGGG - Intronic
1120432995 14:84443667-84443689 ATTGTGTTCCAGAGAGAGAAAGG + Intergenic
1120613986 14:86678831-86678853 TTGTTTTTATAGACAGAGAAGGG + Intergenic
1202846511 14_GL000009v2_random:182449-182471 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1124046384 15:26154613-26154635 TTGGAGTACCAGAAAGAGATGGG - Intergenic
1124209806 15:27753426-27753448 ATGGTTTTTAAGAATGAGAAGGG + Intergenic
1124414686 15:29465318-29465340 TTGGTTCTCCAGGAAGAGCCAGG + Intronic
1124903480 15:33846187-33846209 TTGGGTTTCCAAAAAGAGCATGG + Intronic
1125095914 15:35851009-35851031 TTAGATTTCCAGATACAGAAGGG + Intergenic
1125248119 15:37665584-37665606 TTGGTGTCCCTGAAAGAGACAGG - Intergenic
1125714418 15:41811164-41811186 ATGGTTTTCCTGCAAGAGATGGG - Exonic
1127188873 15:56508317-56508339 TTGGTGTACCTGAAAGAGATAGG + Intergenic
1127910703 15:63413741-63413763 TTGGTTCTCCTGAAAGTGTAAGG - Intergenic
1128576583 15:68780132-68780154 TTACTTTTCCAGAAGAAGAAAGG - Exonic
1129796383 15:78380560-78380582 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
1129873342 15:78955920-78955942 TTGGGATTGCAGTAAGAGAAAGG + Intergenic
1130382763 15:83385036-83385058 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1130553510 15:84906992-84907014 TTGGCTTTATAGACAGAGAAAGG + Intronic
1130618444 15:85435340-85435362 TTGGTGTACCTGAAAGTGAAGGG + Intronic
1131025751 15:89140071-89140093 TGGGTTTTGCAGAAAGAGAGGGG + Intronic
1131765342 15:95669459-95669481 TAGGTTTTTAAGAAAAAGAAAGG + Intergenic
1131840647 15:96433139-96433161 TTGGTTTTCTTTAAACAGAAAGG + Intergenic
1131870449 15:96758281-96758303 TTGGTATTCCAGCACGTGAATGG - Intergenic
1131930373 15:97434215-97434237 TTGGTGTACCAGAAAGTGACGGG + Intergenic
1132079825 15:98854456-98854478 ATGATTTACCAGACAGAGAAGGG - Intronic
1132412726 15:101596646-101596668 TTGGTGTTCCAGAGGAAGAAGGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133628521 16:7594772-7594794 TTTGTTAACCAGAAAGGGAAAGG - Intronic
1134471176 16:14527338-14527360 TTGGTTTTATAGATAGAGAAGGG - Intronic
1135812139 16:25597741-25597763 TTCTTTTTCAAGAATGAGAAAGG - Intergenic
1136652977 16:31688701-31688723 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1137237874 16:46630008-46630030 GTGGGGTTCCAGAAACAGAACGG + Intergenic
1137355092 16:47754569-47754591 TTTATTTTCCAGACAGAGTAAGG + Intergenic
1137406379 16:48192713-48192735 TTGGTCTTCAAGAAAGAACAGGG + Exonic
1137695184 16:50456755-50456777 TTAGGATTCCAGAAAGGGAAAGG - Intergenic
1138007191 16:53349036-53349058 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
1138637305 16:58351361-58351383 TTAATTTTCAAGAAAGAGGAGGG + Intronic
1139066466 16:63321729-63321751 ATTGTTTTCCAGAATAAGAATGG + Intergenic
1139243111 16:65414408-65414430 GTGGTTTTCAAGAATCAGAAAGG - Intergenic
1140077446 16:71714727-71714749 TTGGTTCTCGAGAAAGAGACTGG - Exonic
1140686487 16:77438405-77438427 TTGATTTTAAAGGAAGAGAAAGG - Intergenic
1140710022 16:77668993-77669015 TTTGTTGTTCAGAAGGAGAAAGG - Intergenic
1141001068 16:80308484-80308506 TTACTATGCCAGAAAGAGAAGGG - Intergenic
1141011929 16:80409593-80409615 TTGGTATCCCAGAAAGAGAAAGG + Intergenic
1141071212 16:80956192-80956214 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1141099801 16:81188988-81189010 TTTTTTTTGCAGAAAGATAAAGG - Intergenic
1141131868 16:81443002-81443024 TTGGTGCTCCAGGAACAGAAAGG - Intergenic
1141378046 16:83549720-83549742 TTGAATTTCCAATAAGAGAAAGG + Intronic
1142377707 16:89714995-89715017 TTGGAGTTCCAGAAAGAAAATGG - Intronic
1143432331 17:6896175-6896197 TTGGTTCTGCAGAAAGTGATTGG + Intronic
1144222707 17:13114539-13114561 TGAGATTTCCAGATAGAGAAAGG + Intergenic
1146960177 17:36968083-36968105 TAGGCCTTCCAGAAAGAGAGAGG - Intronic
1148063267 17:44851015-44851037 TTGGGCTCACAGAAAGAGAAGGG - Exonic
1148202696 17:45760246-45760268 TGGGGTTTCGAGAAACAGAAAGG + Intergenic
1148508490 17:48147601-48147623 GAGATTTTCCAGAAGGAGAAAGG + Intronic
1148817565 17:50341009-50341031 TTGGGCTTACAGACAGAGAAGGG + Intergenic
1149043849 17:52221452-52221474 TCTCTTTTCCAAAAAGAGAAAGG - Intergenic
1149160007 17:53681177-53681199 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1149193104 17:54087149-54087171 TTGGTGTGCCAGAAAGTGATGGG + Intergenic
1150528478 17:65951538-65951560 TTGATTTTCTAGAAAATGAAAGG - Intronic
1150690022 17:67357528-67357550 CTGCTTTTCCAGAGAGAGAAGGG + Exonic
1150696986 17:67414025-67414047 TTGGTATTCAATAAAGAAAAAGG - Intronic
1151329920 17:73400627-73400649 CTGGTATTCCTGAAAGACAAGGG + Intronic
1151883300 17:76907917-76907939 TTGCATTTCCTGAAAGATAATGG + Intronic
1151953884 17:77371114-77371136 TTGGGTTTCCTGAAAGAGCTCGG + Intronic
1151997878 17:77622066-77622088 TTGGCTTTATAGACAGAGAAGGG - Intergenic
1152404537 17:80089078-80089100 TTGGTTTTCTGGGAAGTGAAGGG - Intronic
1153611813 18:6893497-6893519 ATGGTTTTCCAGAGTGAAAATGG - Intronic
1153926784 18:9841649-9841671 TTGGCTTTATAGACAGAGAAGGG + Intronic
1154326419 18:13394261-13394283 ATGGTTTACCAGGAAGAAAATGG - Intronic
1154382082 18:13861891-13861913 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
1155296163 18:24386207-24386229 ATTGTTTTTAAGAAAGAGAAAGG + Intronic
1155429989 18:25744948-25744970 TTGGGGTACCTGAAAGAGAAGGG + Intergenic
1155885794 18:31206623-31206645 TTGGTGTGCCAAAAAGAGAAAGG - Intergenic
1156090034 18:33455972-33455994 TGGGATTTCCAGCAAGAGATTGG - Intergenic
1156633778 18:39001873-39001895 TTGGTTCCCTAAAAAGAGAATGG - Intergenic
1156932498 18:42661914-42661936 TTGGTTTACCTGAAAGTGACGGG + Intergenic
1157061906 18:44301379-44301401 TTGGTGTACCTGAAAGAGACAGG + Intergenic
1157271656 18:46280908-46280930 TTGATTTTGCAACAAGAGAAAGG + Intergenic
1157739207 18:50077091-50077113 TTCGTTTTTAAGAAACAGAATGG + Intronic
1158152902 18:54392750-54392772 TCAGGTTTCCAGAAGGAGAAAGG - Intergenic
1158303989 18:56084405-56084427 GTCTTTTTCCAGAGAGAGAATGG + Intergenic
1158377377 18:56886009-56886031 TTGGTGTTCCTGAGAAAGAAGGG + Intronic
1158638121 18:59179034-59179056 TTGCTTTGCCATAAAGAGAGAGG - Intergenic
1158676829 18:59528094-59528116 TTGGGGTACCTGAAAGAGAAGGG - Intronic
1158776327 18:60585132-60585154 TTTATTTTCCAGATAGACAATGG + Intergenic
1159135033 18:64327440-64327462 TAGGTTTTCCAGAAATACAGGGG - Intergenic
1161432705 19:4242854-4242876 TTGGTTTTATAGACAGAAAAAGG + Intergenic
1162108716 19:8388035-8388057 TTGGTTTTACAGGCAGAAAAAGG - Intronic
1162611993 19:11763115-11763137 TTGGTTAAACAGAAAGAGAAGGG + Intergenic
1163189787 19:15669344-15669366 TTGGGTTTCTGGAAAGAGGATGG + Intergenic
1163265102 19:16215782-16215804 TTGGTGTCCCTGAAAGAGATGGG - Intronic
1164082472 19:21871542-21871564 TATGTTTACCAGAAAGAAAATGG + Intergenic
1164178663 19:22800736-22800758 TTGGAGTTCCTGAAAGAGACAGG - Intergenic
1164190096 19:22907127-22907149 TATGTTTACCAGAAAGAGAAGGG + Intergenic
1164833903 19:31344703-31344725 TGGGATTTCTGGAAAGAGAAAGG - Intronic
1166030299 19:40120331-40120353 GTGGTTTTACAGACAGAAAAGGG + Intergenic
1166031970 19:40138113-40138135 TCTGTTCTCCACAAAGAGAAGGG + Intergenic
1166778727 19:45328436-45328458 CTGGCTCTCCAGGAAGAGAAAGG - Intergenic
925553804 2:5106224-5106246 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
925839578 2:7978972-7978994 ATGGTTTTCCAGAAACCGAGGGG + Intergenic
925869810 2:8260105-8260127 TTCCTTTTCTAGAAAGACAATGG - Intergenic
926577140 2:14594732-14594754 TTGGTATTCTAGAGACAGAATGG + Intergenic
927568396 2:24136029-24136051 AGGGTTATCCAGGAAGAGAAGGG - Intronic
928433504 2:31239184-31239206 ATGGTTCTCCAGAAAGCCAAAGG + Intronic
928488433 2:31755880-31755902 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
928830698 2:35479117-35479139 TTGGTTTACCTGAAAGTGATGGG + Intergenic
929084044 2:38149911-38149933 TTGGTTTTACAGACAGAAAAGGG - Intergenic
929170821 2:38931610-38931632 CTGGTTTTCCAGAGAAAGACAGG - Intronic
930359482 2:50359632-50359654 TTGGTCTACCTGAAAGTGAAGGG + Intronic
930467526 2:51773659-51773681 TTGGTGTACCAGAAAGTGACGGG - Intergenic
930840059 2:55836138-55836160 TTGGTGTACCAGAAAGTGACGGG - Intergenic
930925946 2:56817976-56817998 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
930939378 2:56996315-56996337 TTGGTATTCCTGAAAAGGAAGGG - Intergenic
931090158 2:58877018-58877040 TGTGATTTCTAGAAAGAGAAAGG - Intergenic
931170329 2:59796538-59796560 TTTGTTTTGCACAAAGAGAAGGG + Intergenic
931372373 2:61675764-61675786 TTGGCTTTATAGACAGAGAAAGG + Intergenic
932377415 2:71250027-71250049 TTGGTGTACCAGAAAGTGACGGG - Intergenic
933012481 2:77085081-77085103 TTTCTTTTCCAGCAATAGAAAGG - Intronic
933429526 2:82157766-82157788 TTGGATTTCCACAAAGTGAAAGG + Intergenic
934052065 2:88219476-88219498 TGGGTTTCCTATAAAGAGAAGGG - Intergenic
934099907 2:88642761-88642783 TTGGTGTACCTGAAAGAGATAGG + Intergenic
934699279 2:96426563-96426585 TAGTTGTTCCAGAATGAGAAAGG + Intergenic
935449410 2:103191519-103191541 TTGGTGTTCCTGAAAGAGATGGG + Intergenic
935469417 2:103439212-103439234 CTGGTTTTCAAGAAAGAGTTTGG - Intergenic
935546792 2:104408198-104408220 TTGTTTTTTCAGAAAAAAAAAGG - Intergenic
935807210 2:106760903-106760925 TTGGCTTTACAGACAGAAAAGGG - Intergenic
936908936 2:117570746-117570768 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
936995658 2:118411108-118411130 TTGGTTTACCTGAAAGTGATGGG + Intergenic
937022474 2:118670682-118670704 TTTGTTTTCCAAAAAAAAAAAGG + Intergenic
937061141 2:118981397-118981419 TTGGTTTTTCAGGAAGCAAAGGG + Exonic
937063924 2:119002952-119002974 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
937186642 2:120050281-120050303 TTGGTGTACCTGAAAGTGAAGGG - Intronic
937248234 2:120507660-120507682 TTGATTTTCCACAAAGATAGAGG - Intergenic
939089827 2:137766926-137766948 TTGGTTTTATAGACAGAAAAGGG + Intergenic
939193256 2:138941568-138941590 TTGGTGTACCAGAAAGTGACTGG - Intergenic
939459782 2:142484924-142484946 TTTTTTTTCCAGAGAGAGATGGG - Intergenic
939773668 2:146357534-146357556 TTGGCTTTCTAGAGAAAGAAGGG - Intergenic
940009348 2:149038392-149038414 TTGGTTTTCTAGGAAGAAAGGGG + Intronic
940042099 2:149371479-149371501 TTAGTTTACCAAAAAGAGGATGG + Intronic
940994412 2:160132536-160132558 TTAGTTTTCTATAAAGATAATGG + Intronic
941295260 2:163730961-163730983 TTGGTTTAATAGAAATAGAAAGG - Intronic
941614842 2:167707559-167707581 CTGGTTTTCAAGATGGAGAAAGG - Intergenic
941955386 2:171199038-171199060 TTGTTTTTCAAAAAAGGGAAAGG + Intronic
942380000 2:175380477-175380499 GTTGTTTTCCAGAAAGAATATGG + Intergenic
942405384 2:175648258-175648280 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
942414827 2:175747616-175747638 TGTCTTTTCCAGAAAGAAAAAGG + Intergenic
942421319 2:175811034-175811056 CTGGTTTTGAAGAAAGAGAAAGG - Intergenic
942529282 2:176891292-176891314 TTGGATGTCCTGAGAGAGAAGGG - Intergenic
942655023 2:178206479-178206501 TTGGTTTTCAAGATGAAGAAAGG + Intronic
942754913 2:179329164-179329186 TGGGGTTTCCCCAAAGAGAAAGG - Intergenic
943693696 2:190898138-190898160 TTGTTTTGCAAGAAAGTGAATGG + Intronic
943889606 2:193270322-193270344 TTGATTGCACAGAAAGAGAATGG - Intergenic
944018742 2:195075219-195075241 TTGGTGTACCAGAAAGTGACGGG + Intergenic
944275275 2:197830546-197830568 TTGGTGTACCTGAAAGAGATGGG + Intronic
944599093 2:201285048-201285070 TGGGTTTTCCAGCAAGGGAAGGG - Exonic
944736071 2:202567284-202567306 ATGCTTTTCCGGAAAAAGAAAGG + Exonic
945355352 2:208833094-208833116 TTGGTGTACCAGAAAGTGATGGG + Intronic
945366424 2:208960197-208960219 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
945395388 2:209309198-209309220 ATGGTGTTCCAGAAAGATTATGG - Intergenic
945619300 2:212113194-212113216 ATGATTTTCCAAATAGAGAAGGG + Intronic
945658348 2:212653586-212653608 TTATTTTTCCATGAAGAGAATGG + Intergenic
945761621 2:213922138-213922160 TTGGTGTCCCTGAAAGAGACAGG - Intronic
945791295 2:214309003-214309025 TTGGTGTACCTGAAAGAGATGGG - Intronic
946643434 2:221808295-221808317 CTGGTTTTCAGGGAAGAGAAAGG - Intergenic
946709797 2:222494123-222494145 CTGGTTTTACAGACAGGGAAGGG - Intronic
946772500 2:223103130-223103152 TTGGCTTTACAGACAGAAAAGGG + Intronic
947059340 2:226145099-226145121 GAGGTGTACCAGAAAGAGAAAGG - Intergenic
947425860 2:229982327-229982349 TTGGCTTTGCAGATAGAGGAAGG - Intronic
947887136 2:233582457-233582479 TTGGTTTACCTGAAAGTGATGGG - Intergenic
948663382 2:239520223-239520245 TTGGACTTCTGGAAAGAGAACGG + Intergenic
948944662 2:241213407-241213429 CTGGTTTTTCAGAAAGCAAATGG + Intronic
1169276616 20:4237385-4237407 TTGTTTTTAAAGAAAGAGACAGG - Intronic
1169531479 20:6489773-6489795 TTGGTTTTTCAGGGAGAGAGGGG - Intergenic
1170143724 20:13150482-13150504 CTGGTTTTAAAGAAAGAGATAGG - Intronic
1170229235 20:14027074-14027096 TTGGTGTACCTGAAAGTGAAGGG - Intronic
1170427511 20:16249586-16249608 TCGTGTTTCCAGAAAGAAAAGGG - Intergenic
1170436189 20:16331753-16331775 TTGGCTTTCCTGAAAGAGTTAGG + Intronic
1170492295 20:16890168-16890190 TTGGTATACCTGAAAGAGATGGG + Intergenic
1170719697 20:18865830-18865852 TTGGTATACCAGAAAGTGATGGG - Intergenic
1170720297 20:18872016-18872038 TTGGTGTACCAGAAAGTGACTGG - Intergenic
1171056821 20:21915472-21915494 TTGGTGTACCAGAAAGTGATGGG - Intergenic
1171268106 20:23789974-23789996 TTGGTGTTCCTGAAAGTGACGGG + Intergenic
1171933199 20:31247248-31247270 TTGGCCTTGTAGAAAGAGAAGGG + Intergenic
1172161446 20:32871582-32871604 TTGGTTTTTTAAAATGAGAAAGG - Intronic
1173317084 20:41954790-41954812 GGAGTTTTCCAGAGAGAGAAAGG - Intergenic
1174436177 20:50508777-50508799 TTGGTTTTATAGACAGAAAAGGG + Intergenic
1174657459 20:52183406-52183428 TTGGTTTTCGAGGACAAGAAAGG + Intronic
1178136090 21:29629398-29629420 GTGATTTTGGAGAAAGAGAATGG + Intronic
1178194016 21:30321842-30321864 ATGGTTTTCCATGAAGAGAAGGG + Intergenic
1178223479 21:30687641-30687663 TTTGTCATCCAGAGAGAGAAAGG + Intergenic
1180122039 21:45759677-45759699 TTGGTTTTCCAGAAAGAGAAGGG + Intronic
1180414828 22:12699098-12699120 TTGGTTTACCTGAAAGTGACAGG + Intergenic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1181861094 22:25818743-25818765 TTGGTTTTGCAGGTGGAGAAGGG + Intronic
1182229678 22:28828080-28828102 TTGGTTCTAGAGAAAGTGAAAGG - Intergenic
1182707868 22:32299272-32299294 TTGGTTTACCTGAAAGTGATGGG - Intergenic
1182950446 22:34370352-34370374 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1184089980 22:42287721-42287743 GTGGTTTTCCAGCAGTAGAATGG - Intronic
949529038 3:4935501-4935523 TTCATGTTCCAGAAACAGAAAGG - Intergenic
949660322 3:6271511-6271533 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
949861357 3:8508084-8508106 CTGGTTTTCCAGAAGGCTAATGG + Intronic
950961886 3:17116276-17116298 TCTGTTTTTCAGAAAGAAAAGGG - Intergenic
951073226 3:18357726-18357748 TTGTTTTTTCAGACAGAAAAAGG - Intronic
951196908 3:19834943-19834965 CTGGTTTTATAGTAAGAGAAAGG - Intergenic
951258921 3:20483152-20483174 TTGGTATGCCTGAAAGAGATGGG + Intergenic
951324307 3:21284357-21284379 TTGGTTTACCTGAAAGTGATGGG - Intergenic
952076605 3:29704333-29704355 TGTGTATTCCAGAAAGAGATTGG + Intronic
952703367 3:36349774-36349796 TTGGTCTTCCAAAAGAAGAAGGG + Intergenic
952813859 3:37429972-37429994 TTGGTGTTCCTGAAAGTGACAGG - Intronic
953009478 3:39011068-39011090 GAGGTTTTGCAGCAAGAGAAAGG + Intergenic
953094484 3:39761531-39761553 TTGGTTTTGTAGACAGAAAAGGG + Intergenic
953841874 3:46395825-46395847 CTGGTTTACCAGATAGGGAAGGG + Intergenic
954480441 3:50795344-50795366 TTGGTGTCCCTGAAAGAGACAGG - Intronic
954823986 3:53354932-53354954 TTGGCTTTACAGGCAGAGAAGGG + Intergenic
955681200 3:61504026-61504048 TTGGTATACCTGAAAGAGATGGG - Intergenic
955988730 3:64602219-64602241 TTGAATGTTCAGAAAGAGAAAGG + Intronic
956243567 3:67155807-67155829 TTGGTGTGCCAGAAAGTGACGGG + Intergenic
956317018 3:67949291-67949313 TTGGTGTACCAGAAAGTGACGGG + Intergenic
956693552 3:71899886-71899908 ATGGCTTTCCAGAAAGCTAATGG - Intergenic
956812519 3:72877944-72877966 CTGTTTTTCCAAAGAGAGAAGGG + Intergenic
957005300 3:74938756-74938778 TTAGGTTTCCAGAGGGAGAATGG + Intergenic
957269533 3:78011467-78011489 TTTGTTTTCAAATAAGAGAAAGG - Intergenic
958200746 3:90311696-90311718 TTGGTTTACCTGAAAGTGATGGG - Intergenic
958257307 3:91340012-91340034 TTGGTGTTCCTGAAAGTGATGGG - Intergenic
958413843 3:93851374-93851396 TTGGTTTACCTGAAAGTGACAGG - Intergenic
958423163 3:93951119-93951141 TTGGTGTACCTGAAAGTGAAGGG + Intronic
958573482 3:95917001-95917023 TTCGTTTTCCAGAAAGAGCAGGG + Intergenic
958585996 3:96088445-96088467 TTGGCTTTCTAAAAAGAAAAAGG - Intergenic
958590763 3:96155554-96155576 TTGGTGTACCTGAAAGAGATGGG + Intergenic
958702974 3:97616806-97616828 TTGGTGTACCTGAAAGAGATGGG + Intronic
958742768 3:98095025-98095047 TTGGTGTACCAGAAAGTGACAGG - Intergenic
959080985 3:101801064-101801086 TTGGGCTTCCGGGAAGAGAAAGG - Intronic
959309685 3:104717921-104717943 TTATTTTTACAGAAAGAGGAAGG - Intergenic
959930282 3:111973975-111973997 TTTTTTTTCCTCAAAGAGAACGG - Intronic
960044182 3:113180219-113180241 TTGGGTCTTCAGAAAGTGAAAGG + Intergenic
960105788 3:113795162-113795184 TTGGAAATCCTGAAAGAGAAGGG + Exonic
960511472 3:118554461-118554483 ATGGTTGTTCAGAAAGAGAATGG - Intergenic
960541687 3:118868953-118868975 TTGGTTTCCCAGAAAAAGCATGG + Intergenic
960626240 3:119685069-119685091 TGGGGTTTTCAGAAAGGGAAGGG - Intergenic
962233849 3:133691709-133691731 TTCATTTGCCTGAAAGAGAAGGG - Intergenic
962335409 3:134526048-134526070 TTGGTGTCCCTGAAAGAGATGGG - Intronic
962831996 3:139151095-139151117 TTGGTGTTCCTGAAAGAGATGGG + Intronic
963048363 3:141121529-141121551 TTGGTATTCCTGAAAGTGATGGG - Intronic
963830671 3:150005341-150005363 TAGGTTTTCTAAAAAGAGACTGG + Intronic
964289049 3:155155172-155155194 TTTGTTTTCCAGAGGGGGAAGGG + Intronic
964404514 3:156335014-156335036 TTGGTCTTCCAGAAACAAATCGG + Intronic
965017195 3:163173280-163173302 TTGGTGTACCTGAAAGTGAAAGG - Intergenic
965125848 3:164627998-164628020 TTGGTTTAAAAGAAAAAGAAAGG + Intergenic
965319277 3:167231840-167231862 TTGGAATTCCATAAAGAAAATGG + Intergenic
965883190 3:173411936-173411958 TTGTATTTTCTGAAAGAGAATGG + Intronic
965921169 3:173915774-173915796 ATGGTTTTCTGGAAAGAAAAAGG - Intronic
965986317 3:174757971-174757993 TTTGTTTTCCAGAAATGGAAAGG + Intronic
966290055 3:178344677-178344699 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
966320671 3:178698213-178698235 TTGGTGTCCCTGAAAGAGATGGG - Intronic
966652204 3:182314249-182314271 TTGGAGTACCTGAAAGAGAAGGG - Intergenic
966888883 3:184391882-184391904 TTGGTTTTTTGGAAAGGGAAAGG - Intronic
967091936 3:186142028-186142050 TTGGGTTTCCAGTTTGAGAAGGG + Intronic
967241634 3:187445275-187445297 CTGGTTCTCTAGAAAGAGACTGG + Intergenic
967674088 3:192275399-192275421 TTGGTTTTACAAACAGAAAAGGG - Intronic
967703659 3:192623574-192623596 TTTGTTTTGCAGAAAGAGCAAGG + Intronic
967845050 3:194036340-194036362 TTCGTTTCCCAGAAATAAAATGG - Intergenic
967958017 3:194893136-194893158 TAGGAGTTCCAGAAAGAAAATGG + Intergenic
967967361 3:194972497-194972519 TGGGTTTTCCCAAAATAGAAAGG - Intergenic
968012346 3:195292442-195292464 TTTGCTTTTCAGAAGGAGAAAGG - Exonic
968383549 4:115341-115363 TTGGTTGTCCAGCAAGAATATGG - Intergenic
968769929 4:2498517-2498539 TGTGTTCACCAGAAAGAGAATGG + Intronic
970009780 4:11446377-11446399 TAAGTTTGCCAGAGAGAGAAAGG + Intergenic
970156050 4:13142719-13142741 CTGGTTTTCCAGAAAAATATTGG - Intergenic
970655253 4:18223932-18223954 TTGGTGTACCAGAAAGTGACAGG - Intergenic
970845130 4:20528420-20528442 TTGATTTTGTAGAAAGAGACAGG - Intronic
971004644 4:22359076-22359098 TTGGTATACCAGAAAGTGACAGG + Intronic
971033893 4:22671603-22671625 TTGGTTGTACAGATTGAGAAGGG + Intergenic
971060060 4:22957949-22957971 TTTTTCTTCTAGAAAGAGAAAGG + Intergenic
971106150 4:23525998-23526020 TTGGCATTCCTGAAAAAGAAGGG + Intergenic
971187342 4:24392699-24392721 GTTGTCTTCCAGAAAGAGAAAGG - Intergenic
972194741 4:36640007-36640029 TTTGTTTTTCAGAGAGAAAATGG - Intergenic
972322230 4:37982622-37982644 TTGGTTTTACTGAAAGAGAATGG + Intronic
972498070 4:39652464-39652486 CTGGCTTTACAGACAGAGAAGGG - Intergenic
973207716 4:47578824-47578846 TTGATTTTCCAGAGAACGAAGGG + Intronic
974371261 4:61019530-61019552 TTGGTTTACCTGAAAGTGACAGG + Intergenic
974654461 4:64801004-64801026 TTGGTGTTCCTGAAAGTGACAGG + Intergenic
974745833 4:66074611-66074633 TTAGTGTTCCTGAAAGAGATGGG - Intergenic
974787972 4:66645921-66645943 TTGATTCTCTAGAAAGAGAAAGG + Intergenic
974803616 4:66851717-66851739 TTGGATTTGGAGAAAGATAAAGG + Intergenic
974837869 4:67272798-67272820 TTGGTGTACCAGAAAGTGATGGG - Intergenic
975265600 4:72362521-72362543 ATGATATTCCAGAAAGAAAATGG - Intronic
975309158 4:72883371-72883393 TTGGTTTACCTGAAAGTGACAGG - Intergenic
975361094 4:73473195-73473217 TTAGTGTTCCTGAAAGAGATGGG - Intergenic
975887272 4:78981061-78981083 TTGGTGTTCCTGAAAGTGATGGG - Intergenic
975899040 4:79128400-79128422 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
975968716 4:80007698-80007720 CTGGCTTTGCAGATAGAGAAAGG + Intronic
975999719 4:80359434-80359456 TTGGTGTCCCTGAAAGAGATGGG - Intronic
976097991 4:81529010-81529032 TTGGTTTTTCTGAAAGTGATAGG + Intronic
976552450 4:86412517-86412539 TTGGTGTACCAGAAAGTGACAGG - Intronic
976796661 4:88941432-88941454 TTGGTTTTATAGACAGAAAAAGG - Intronic
977051263 4:92130605-92130627 TGGGTTTTCCTGGAAGAGGATGG + Intergenic
977185502 4:93931423-93931445 TTGGTGTTCCTGAAAGTGACAGG - Intergenic
977306159 4:95325891-95325913 TTGTTTTCCCAGGAAGAGAAGGG - Intronic
977315115 4:95436983-95437005 TTTTTTTTCAAGAAAGAAAAAGG - Intronic
977388355 4:96374204-96374226 TGCATTTTCCAGAAAGAAAATGG - Intergenic
977457449 4:97279494-97279516 TTCGTTTTCCAGAAAGACTATGG - Intronic
977480135 4:97565051-97565073 TTGGTGTACCTGAAAGTGAAGGG - Intronic
977761276 4:100739832-100739854 TTTTTTTTTCAGAAAGAAAACGG - Intronic
977975062 4:103254886-103254908 TTGGTTTACCTGAAAGTGATGGG - Intergenic
978176117 4:105734304-105734326 TTGGTTTACCTGAAAGTGACGGG - Intronic
978464673 4:108995493-108995515 TTGGTGTACCAGAAAGTGACGGG + Intronic
979009862 4:115354239-115354261 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
979074636 4:116256523-116256545 TTGGTGTACCAGAAAGTGATGGG - Intergenic
979159880 4:117446934-117446956 TTGGTGTTCCTGAGAAAGAAGGG - Intergenic
979298300 4:119057415-119057437 CTGATCTTCCAGGAAGAGAAAGG - Exonic
979439345 4:120733203-120733225 TTTGTTTCCCAGTGAGAGAATGG - Intronic
979447891 4:120836178-120836200 TTTGTTCTTAAGAAAGAGAAGGG + Intronic
979462554 4:121000622-121000644 TTGGTTTACCTGAAAGTGACGGG - Intergenic
980471737 4:133261950-133261972 TTGGTTTTCAAGAAAGAGTGTGG - Intergenic
980558599 4:134441756-134441778 TTGGTGTTCCTGAAAGTGATGGG - Intergenic
980617797 4:135254789-135254811 TTGGTTTTCCAAATCCAGAAGGG + Intergenic
981211743 4:142115185-142115207 TTGGTTTACCTGAAAGTGACAGG + Intronic
981358945 4:143825474-143825496 TTTTTCTTCAAGAAAGAGAAGGG + Intergenic
981369727 4:143946360-143946382 TTTTTCTTCAAGAAAGAGAAGGG + Intergenic
981379461 4:144056318-144056340 TTTTTCTTCAAGAAAGAGAAGGG + Intergenic
981721683 4:147808331-147808353 TTTTTTTTCCAGGAACAGAAGGG + Intronic
981872661 4:149505766-149505788 TTGATTTTCTAGATAGAGAATGG - Intergenic
981899875 4:149849594-149849616 TTGGTGTACCAGAAAGTGATGGG + Intergenic
981905468 4:149916914-149916936 TTGGTGTACCAGAAAGTGATGGG + Intergenic
982003096 4:151038979-151039001 TGAGTTTTCCAGAAAGAGATGGG - Intergenic
982906158 4:161075756-161075778 TATGTTTCCTAGAAAGAGAAAGG + Intergenic
982910434 4:161135062-161135084 TTGGTTTTTATAAAAGAGAAGGG + Intergenic
983136255 4:164085147-164085169 TTGGTTTTCAAGCAATTGAAAGG + Intronic
983183680 4:164677409-164677431 TTGGTGTACCAGAAAGTGACTGG + Intergenic
984144306 4:176042952-176042974 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
984314917 4:178116516-178116538 TTGGCTTTACAGACAGAAAAGGG - Intergenic
984354348 4:178638509-178638531 TTGGTTTACCTGAAAGTGATGGG + Intergenic
984509022 4:180656501-180656523 ATACGTTTCCAGAAAGAGAAAGG + Intergenic
984760126 4:183356574-183356596 TTGGTTGTCCAGAGAGAGCATGG - Intergenic
985339945 4:188939953-188939975 TTGGCTTTACAGACAGAAAAGGG - Intergenic
986656233 5:10015631-10015653 TTGGTCTTCCTGAAAGTGATGGG - Intergenic
986766537 5:10933090-10933112 TTGTGTTCCCTGAAAGAGAAAGG - Intergenic
986903865 5:12469353-12469375 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
986909190 5:12533466-12533488 TTTGTGTCCCAGAAAGAGAAGGG + Intergenic
987451513 5:18089586-18089608 TTGGAAATCAAGAAAGAGAAAGG + Intergenic
987977402 5:25032364-25032386 TTGGTATCTCAGAAAGAGAGGGG - Intergenic
988057275 5:26114380-26114402 TTGGTGTATTAGAAAGAGAAGGG + Intergenic
988192846 5:27962372-27962394 TTGGTATTTCTGAAAGAGATGGG - Intergenic
988677913 5:33452801-33452823 TTAGCTTTGTAGAAAGAGAAAGG + Intronic
988865140 5:35325881-35325903 CTGGTGTCCCAGAAAGAGATGGG + Intergenic
989493088 5:42079669-42079691 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
989959949 5:50401101-50401123 TATGTTCTCCAGAAAGAGAAGGG + Intronic
990179323 5:53142584-53142606 TTGGTGTACCAGAAAGTGACGGG + Intergenic
990351337 5:54919535-54919557 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
990692133 5:58376196-58376218 TTGGTGTTCCTGAAAGTGACGGG - Intergenic
990706964 5:58540753-58540775 TTGGTGTTCCTGAAAGCGACGGG - Intergenic
990736569 5:58869932-58869954 TTGATTTTGAAGAAGGAGAATGG + Intergenic
990945046 5:61240378-61240400 TTGGTGTACCAGAAAGTGATGGG + Intergenic
990988812 5:61665139-61665161 TTAGTTTTCTATAAAGAGCAGGG + Intronic
991419152 5:66423422-66423444 TAGGGTTTCCAGAAGAAGAAGGG + Intergenic
991634755 5:68693097-68693119 TTGGTTTACCAGAAAGTGACAGG + Intergenic
992152710 5:73921457-73921479 TATCTTATCCAGAAAGAGAATGG - Intronic
992926533 5:81593365-81593387 TTGGTGTACCTGAAAGTGAAGGG + Intronic
992949811 5:81847888-81847910 TTGGTTTACCGAAAAGAGACTGG + Intergenic
993211107 5:84952302-84952324 CTGGCTTTTCAGAAAGAGAAAGG - Intergenic
993355533 5:86902580-86902602 TTGGTTTTACAGAAGGAGGAGGG - Intergenic
993551030 5:89274052-89274074 TTTGTTTCCCTGAATGAGAAGGG + Intergenic
993779585 5:92050070-92050092 TTGGCATTCCTGAGAGAGAAGGG - Intergenic
994015193 5:94956793-94956815 TTGGTGTACCTGAAAGTGAAGGG + Intronic
994139730 5:96328786-96328808 TCGCTTTTCCACAATGAGAAAGG - Intergenic
994287966 5:97992827-97992849 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
994437908 5:99762419-99762441 TTGGTGTACCAGAAAGTGACAGG - Intergenic
994585116 5:101697570-101697592 TTGGTTTTCCAGTAAAAGTGTGG + Intergenic
994969550 5:106718484-106718506 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
995067998 5:107883887-107883909 ATGGTTTTCCAGATAAACAAAGG + Intronic
995188124 5:109292108-109292130 TTGGTGTACCTGAAAGAGATGGG + Intergenic
995202886 5:109446234-109446256 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
995204059 5:109458764-109458786 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
995258504 5:110074394-110074416 TCGATTTCCCAGAAAGAGATGGG - Intergenic
995270600 5:110216118-110216140 TTGGTGTACCAGAAAGTGACAGG - Intergenic
995795665 5:115938985-115939007 CTGGTTTTCCACAAAGGGATAGG - Intergenic
995832006 5:116363698-116363720 TGAGTTTGACAGAAAGAGAAAGG + Intronic
996130101 5:119771057-119771079 TTGGTGTTCCTGAAAGTGACAGG + Intergenic
996248076 5:121290132-121290154 TTAGTTTTTAAAAAAGAGAATGG - Intergenic
996371845 5:122761592-122761614 TTGGTTTTATAGACAGAGAAGGG - Intergenic
996420291 5:123255539-123255561 TTGGTGTACCTGAAAGAGACGGG - Intergenic
996515028 5:124359763-124359785 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
996932087 5:128901775-128901797 TTGGTTTAACAGTAAGTGAACGG - Intronic
997094414 5:130894764-130894786 TTGGTGTTCCTGAAAGTGACAGG + Intergenic
997597231 5:135115130-135115152 TTGGAGCTCCAGAAAGAAAAAGG - Intronic
997802199 5:136874947-136874969 TTGGTTCTTCAAAAACAGAATGG - Intergenic
998270477 5:140701992-140702014 CTGGTTTTCCTGAAACATAATGG - Exonic
998275799 5:140752316-140752338 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
998717873 5:144906606-144906628 TTGGTGTACCAGAAAGTGACAGG + Intergenic
1000249899 5:159483952-159483974 TTTGTTCTGCAGAAGGAGAATGG + Intergenic
1000851065 5:166340928-166340950 TTTGTTTCCCAGACAAAGAAGGG + Intergenic
1001413154 5:171524872-171524894 TTGGTTTTCCAGCAAGAGTAGGG - Intergenic
1001839137 5:174858675-174858697 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1002302171 5:178263316-178263338 TTGGTCTCCCTGAAAGAGATGGG + Exonic
1002413405 5:179102453-179102475 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1003228329 6:4226472-4226494 TTGGTGTACCAGAAAGTGACTGG + Intergenic
1004846781 6:19651923-19651945 GTAGTTTTCCAGAAACAAAAAGG - Intergenic
1005019336 6:21402492-21402514 GTGATTTTCAAAAAAGAGAAAGG + Intergenic
1005224084 6:23620914-23620936 TCGATTCTCCAGAGAGAGAAAGG + Intergenic
1005761368 6:28970880-28970902 TTGATTTTAGTGAAAGAGAATGG + Intergenic
1006040315 6:31247340-31247362 TTGGTATACCTGAAAGAGATGGG + Intergenic
1006048713 6:31322555-31322577 TTGGTGTACCTGAAAGAGATGGG + Intronic
1006237254 6:32644726-32644748 TTCTTTTTCCAGAATGAGAGAGG + Intronic
1006252981 6:32806280-32806302 TTGGTGTTCCTGAGAGAGATGGG - Intergenic
1006441277 6:34055239-34055261 CTGGTGTTCCTGAGAGAGAAGGG - Intronic
1006487572 6:34356341-34356363 TTGGTTTTACAGATATCGAAAGG - Intronic
1006591554 6:35161706-35161728 GTTGTTTTCCAGAAGGAAAAAGG + Intergenic
1006770537 6:36548968-36548990 TTGGATTTGCAGACAGAAAATGG - Intergenic
1007845228 6:44748953-44748975 TTGGTGTTCCTGAAAGTGACGGG + Intergenic
1007858859 6:44886140-44886162 TTGGTGTTCCTGAAAGTGACGGG + Intronic
1007975954 6:46101481-46101503 TTGGTTTTGTAGACAGAAAAGGG + Intergenic
1008219771 6:48841741-48841763 TTGGTGTCCCTGAAAGAGACAGG - Intergenic
1008671696 6:53775538-53775560 TTGGTGTACCTGAAAGTGAAAGG + Intergenic
1008688221 6:53947328-53947350 TTGGTGTCCCTGAAAGAGATGGG + Intronic
1008963371 6:57289329-57289351 TTGGTGTTCCTGAAAGTGACGGG + Intergenic
1008997997 6:57681010-57681032 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
1009186486 6:60580349-60580371 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
1009240940 6:61184976-61184998 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
1009263069 6:61520794-61520816 TTGGTGTACCTGAAAGAGACAGG + Intergenic
1009392106 6:63156666-63156688 TTGGTGTTCCTGAAAAAGAAGGG + Intergenic
1009571427 6:65390412-65390434 TAGGGTTTTCAGAAGGAGAAGGG + Intronic
1009734665 6:67661651-67661673 TTGACTTTCCTGAAAGAGATGGG - Intergenic
1009781465 6:68277057-68277079 TTGGCTTGCCAGAAATGGAAGGG + Intergenic
1009816353 6:68740982-68741004 TTGGTTTTCTAAGAAGGGAAAGG + Intronic
1009958700 6:70491507-70491529 TTAGTTTCTCAGAAAAAGAAAGG - Intronic
1010104162 6:72148345-72148367 AGGTTTTTCTAGAAAGAGAAAGG - Intronic
1010361952 6:75005209-75005231 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1010375937 6:75170119-75170141 TTTGCTTTTCAGAAAGAAAATGG - Intronic
1010594737 6:77749643-77749665 TTGGTGTACCTGAAAGAGACTGG + Intronic
1010821179 6:80417948-80417970 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
1011007766 6:82666912-82666934 TTGATGTTGCTGAAAGAGAAGGG - Intergenic
1011201548 6:84842267-84842289 TTGGTGTGCCAGAAAGTGAAAGG - Intergenic
1011338020 6:86282751-86282773 TTGGTGTACCAGAAAGTGATGGG - Intergenic
1011568650 6:88708785-88708807 TACGTTTTCCAGTAAGAAAAGGG + Intronic
1012004946 6:93701914-93701936 TTTGTTTTCCATATATAGAAGGG - Intergenic
1012317302 6:97796145-97796167 TTGGTGTACCAGAAAGTGACGGG + Intergenic
1012598125 6:101063521-101063543 TTGGTGTACCAGAAAGTGATGGG + Intergenic
1012653998 6:101792825-101792847 TTGGTGTACCTGAAAGAGACGGG - Intronic
1012721988 6:102757501-102757523 TTGGTGTTCCTGAAAGTGATGGG - Intergenic
1012868328 6:104644418-104644440 GTGGTTTGTCAGAAAGGGAAAGG - Intergenic
1013083234 6:106831370-106831392 TTGATTTTACAGACAGAAAAGGG - Intergenic
1013256328 6:108389995-108390017 TTGGTGTACCTGAAAGTGAAAGG - Intronic
1013393600 6:109712362-109712384 CTGGTATACCAGAAAGAGAATGG - Intronic
1013461683 6:110380105-110380127 TTGGAGTACCAGAAAGAGATAGG + Intergenic
1013533530 6:111041875-111041897 TTGGTTTTATAGACAGAAAAAGG + Intergenic
1014052375 6:116969723-116969745 TGAGATTTACAGAAAGAGAAAGG - Intergenic
1014207254 6:118669610-118669632 TTGGTTTTTCACAAAGTGACTGG - Intronic
1014305424 6:119735460-119735482 TGGATTTTCCAGAAGGATAAGGG + Intergenic
1014918079 6:127177899-127177921 TTTTTTTTACAAAAAGAGAATGG + Intronic
1015050223 6:128830973-128830995 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1015106891 6:129547492-129547514 GAGGTTTTACAGCAAGAGAAAGG + Intergenic
1015737307 6:136414491-136414513 TTTGTTTTGCTGAAAGAAAATGG + Intronic
1016351616 6:143175417-143175439 TTGGTGTTCCTGAAGAAGAAGGG - Intronic
1016552956 6:145302196-145302218 TTGGTGTTCCTGAAAGTGACGGG - Intergenic
1016659537 6:146561625-146561647 TTGGTGTTCCTGAAAGTGACAGG + Intergenic
1016846816 6:148576377-148576399 TTGGTTTGCCACAAAGAGTTTGG + Intergenic
1016986423 6:149899057-149899079 TTGGTTTTACTGAGAGAAAAAGG - Intergenic
1017256928 6:152343868-152343890 TTGGTAGACTAGAAAGAGAATGG - Intronic
1017762648 6:157582844-157582866 TTGGTGTTCCTGAAAGAGACAGG - Intronic
1017792502 6:157813733-157813755 TTGGCTTTCCAGACAGAAAAGGG + Intronic
1017871828 6:158493478-158493500 CTGGCTGTCCAGAAAAAGAAAGG + Intronic
1019071747 6:169352486-169352508 TTGGTATACCAGAAAGTGATGGG - Intergenic
1019315777 7:385711-385733 TTGCGTTTCCAGAGAGAGAGAGG + Intergenic
1019422795 7:958830-958852 TTGGTTTTCCAAACAGAGATGGG + Intronic
1020454236 7:8353120-8353142 TTGGTGTACCAGAAAGTGATGGG + Intergenic
1021390769 7:20089997-20090019 TTGGTGTACCTGAAAGAGATGGG + Intergenic
1021959028 7:25854024-25854046 TGGGTTTATCAGGAAGAGAAGGG - Intergenic
1021967342 7:25933614-25933636 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1022491442 7:30822967-30822989 TTAGTTTTTCATGAAGAGAATGG + Intronic
1022883453 7:34616248-34616270 TTGATTTTACAGAAATAAAAAGG + Intergenic
1023422880 7:40002010-40002032 TTGGATTTCAAGAAGGACAAAGG + Exonic
1023785536 7:43704431-43704453 TTGGCATTCCTGAAAGAGATGGG - Intronic
1024106024 7:46087544-46087566 TTGGTGTACCAGAAAGTGACGGG - Intergenic
1024144455 7:46498970-46498992 TTGGTGTACCTGAAAGAGACAGG + Intergenic
1024367163 7:48534619-48534641 TTGGTTTTCCTGAGGAAGAAGGG - Intronic
1024427099 7:49239001-49239023 TTGATGTCCCAGAAAGAGATGGG - Intergenic
1024566508 7:50685863-50685885 CTGGTTTTCCAGAATGTGGATGG + Intronic
1024674045 7:51622249-51622271 CTGGTTTTCCACATAGAGTAAGG + Intergenic
1025953518 7:66164852-66164874 ATGGCTTTCCAGAAAAAGCAGGG - Intergenic
1026577786 7:71588144-71588166 TTGTTTTTTTAGAAAGAGTAAGG + Intronic
1026656878 7:72264272-72264294 TTGGTTTTATAGACAGAAAAGGG - Intronic
1027602588 7:80257413-80257435 TGAGTTTTCAATAAAGAGAAAGG + Intergenic
1027627342 7:80562796-80562818 TTGGTGTACCTGAAAGAGATGGG - Intronic
1027672075 7:81113661-81113683 TTTTTTTTCCACAAAGAGATGGG + Intergenic
1028017024 7:85728882-85728904 TTGGGTTTTCAGAAACAAAATGG - Intergenic
1028053441 7:86212654-86212676 ATGATTTTCCAGAAAAAAAATGG + Intergenic
1028077256 7:86532223-86532245 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
1028143096 7:87292710-87292732 TTAGTGTTCCAGAAAGAGAAGGG + Intergenic
1028226780 7:88261210-88261232 TTACTTTTCAAGAAATAGAATGG - Intergenic
1028488005 7:91381124-91381146 TTGGATTTGAATAAAGAGAATGG - Intergenic
1028508037 7:91591166-91591188 TTGGTTTACCTGAAAGTGACGGG + Intergenic
1028836265 7:95378278-95378300 TTGGTGTACCAGAAAGTGACAGG + Intronic
1028905596 7:96151102-96151124 TTGGTAGTCCAGGCAGAGAAAGG + Intronic
1029041608 7:97581618-97581640 TTGGTATACCTGAAAGAGATGGG + Intergenic
1029572366 7:101378753-101378775 TTGCATTTCCAGAACAAGAAAGG - Intronic
1029850036 7:103452469-103452491 TTGGTGTACCTGAAAGAGAAGGG - Intergenic
1031033061 7:116755689-116755711 TTGGATTTGAAGAGAGAGAAAGG + Intronic
1031200735 7:118682008-118682030 TTGTGTTGCCAGAAAGAAAAAGG + Intergenic
1031613615 7:123855815-123855837 TTGGTTTACCTGAAAGTGATGGG - Intronic
1031662933 7:124449458-124449480 TTACTTCTCAAGAAAGAGAATGG - Intergenic
1032977271 7:137240027-137240049 TTGGTTTGGAAGAGAGAGAAGGG - Intronic
1033153242 7:138934795-138934817 GGGGTTCCCCAGAAAGAGAAAGG + Intronic
1033522908 7:142180651-142180673 TTGGCATTCCTGAGAGAGAAGGG - Intronic
1033853601 7:145528361-145528383 TTGATGTTACAGAAAGAGAGAGG + Intergenic
1033905810 7:146200833-146200855 GTGCTTTTCCAGAAGCAGAAGGG - Intronic
1034076954 7:148241285-148241307 TTTGCTTTTAAGAAAGAGAAGGG - Intronic
1034391578 7:150791613-150791635 TTTTTTTTCCAGAATGAGGAAGG - Exonic
1034581989 7:152051545-152051567 TTGGTTTTCCAAACATAAAATGG + Intronic
1035181881 7:157095422-157095444 TTGGTTTTAAAGACAGAAAAGGG - Intergenic
1035356720 7:158280168-158280190 TTGGTGTTCCAGATATGGAAGGG - Intronic
1036287406 8:7456051-7456073 TGGGTTTTCAAGAAAGAGGCAGG + Intronic
1036334074 8:7855474-7855496 TGGGTTTTCAAGAAAGAGGCAGG - Intronic
1036604073 8:10290963-10290985 TGGATTTTCCAGAATAAGAAGGG - Intronic
1036627197 8:10482078-10482100 TTGGGGTTCCAGGAAGAGGATGG + Intergenic
1037524822 8:19714471-19714493 TTGGAATTCCAGAAGGAGACTGG - Intronic
1037728909 8:21507073-21507095 TAGGTTTTCTGGAAAGAGGATGG + Intergenic
1038332686 8:26621698-26621720 ATGGGTTTCCAGAGAGAGAGAGG + Intronic
1038411287 8:27361685-27361707 CTGGGATACCAGAAAGAGAAGGG - Intronic
1038856710 8:31341418-31341440 TTGGTGTTCCAGGAAGAAATAGG + Intergenic
1039032522 8:33325828-33325850 TGGTATTTCCAGGAAGAGAATGG + Intergenic
1039414528 8:37382371-37382393 TTGCTTTTAAAGGAAGAGAAGGG + Intergenic
1039563099 8:38528804-38528826 CTGGGCTGCCAGAAAGAGAAAGG - Intergenic
1040556831 8:48487064-48487086 TTGGTGTACCAGAAAGTGACAGG + Intergenic
1040686548 8:49879740-49879762 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1040749787 8:50691866-50691888 TTGGTGTTCCTGAAAGTGACAGG - Intronic
1041404648 8:57484567-57484589 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1041748093 8:61231242-61231264 TGGGTTTTGCAGGAAGAGACTGG - Intronic
1041951562 8:63509361-63509383 TTGGTGTACCAGAAAGTGATGGG - Intergenic
1041977187 8:63813427-63813449 TTAGTTTTCTAGGAGGAGAAGGG + Intergenic
1042011285 8:64247832-64247854 CTTTTTATCCAGAAAGAGAAAGG - Intergenic
1042349262 8:67760817-67760839 TTGGTTTACCTGAAAGTGACAGG - Intergenic
1042620578 8:70699800-70699822 TTGGTGTTCCTGAAAGTGACAGG - Intronic
1042634226 8:70855501-70855523 TTGGTTTACCTGAAAGTGACGGG + Intergenic
1043742848 8:83835957-83835979 TTTCATTTCCAGAAAGAAAATGG - Intergenic
1043875859 8:85485091-85485113 TTGGTTTTACAACAGGAGAAGGG + Intergenic
1043946104 8:86254517-86254539 TTGGTTTTCTAGATGGAAAAGGG - Intronic
1044285243 8:90403985-90404007 TTGGTTTTACAGAAATTGCATGG - Intergenic
1044313969 8:90727945-90727967 TTGGTGTCCCTGAAAGAGATGGG + Intronic
1045408628 8:101892887-101892909 TTGGTGTACCAGAAAGTGATGGG + Intronic
1045705286 8:104915621-104915643 CTGGTTTACCAGAAGGAGATAGG - Intronic
1046124243 8:109884214-109884236 AGGGTTTTCAAGAAACAGAAGGG - Intergenic
1046153193 8:110255421-110255443 TTGGTGTACCTGAAAGAGACAGG - Intergenic
1046796854 8:118382803-118382825 TTAGTTTTCAAGAAAGATTAAGG + Intronic
1046968332 8:120192663-120192685 TTGGTTTACCTGAAAGTGACGGG - Intronic
1046982319 8:120349760-120349782 TTGGTTTACCTGAAAGTGATGGG + Intronic
1047033181 8:120906052-120906074 TTGCTTTTCAAGCAAGAGGAAGG - Intergenic
1047711549 8:127557744-127557766 TTGGTTTTGAAGACAGAGAAAGG - Intergenic
1048303084 8:133265680-133265702 TTTGTTTTCCAGAGGAAGAAAGG - Intronic
1048540440 8:135336907-135336929 TTGGTGTACCAGAAAGTGACGGG + Intergenic
1049506874 8:143007200-143007222 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
1049595196 8:143480211-143480233 TTGGTTTTCCTGAAAGCCCAGGG + Intronic
1049892339 9:82352-82374 TTAATTTTCCAGGAAAAGAAGGG + Intergenic
1049964763 9:768246-768268 TTGGTGTACCCGAAAGTGAAAGG + Intergenic
1050319963 9:4441956-4441978 TTGGCTTTAGAGAAAGAGTAAGG + Intergenic
1050690954 9:8225352-8225374 ATCATTTTCAAGAAAGAGAAGGG - Intergenic
1050700037 9:8328646-8328668 TTGGTTTACCTGAAAGTGAAGGG - Intronic
1051036008 9:12746335-12746357 TTGGTGTACCAGAAGGAGACGGG - Intergenic
1051045591 9:12869413-12869435 TTGGTTTACCTGAAAGTGATGGG - Intergenic
1051064108 9:13081162-13081184 TTGATTTTCCACAAAGGCAAAGG + Intergenic
1051455766 9:17256674-17256696 TTGGTTTTATAGACAGAAAAGGG + Intronic
1051592792 9:18793534-18793556 TTGTTTTTCAAGAAAGTGAGAGG - Intronic
1052278793 9:26708864-26708886 TTGGTTTTCCAAGTAGAAAAAGG + Intergenic
1052443728 9:28532443-28532465 TTTTTTTTCCAGAAAAAGAAGGG + Intronic
1052514618 9:29463736-29463758 GTGGTATTCCTGAAAGAGATGGG + Intergenic
1052643054 9:31194063-31194085 TAGGATTTCCATAAAGAGAAAGG - Intergenic
1052694233 9:31855293-31855315 TTGGTGTCCCTGAAAGAGAGGGG + Intergenic
1053097298 9:35339726-35339748 TGGGCTTTCCAGAAAAACAAAGG - Intronic
1053505787 9:38642265-38642287 TTGGATTTTCAGAAAGATTAGGG - Intergenic
1053606826 9:39668421-39668443 ATGGTGTTCCAGAGAGAGTATGG + Intergenic
1053864743 9:42425051-42425073 ATGGTGTTCCAGAGAGAGTATGG + Intergenic
1054246710 9:62673981-62674003 ATGGTGTTCCAGAGAGAGTATGG - Intergenic
1054529632 9:66167266-66167288 AGGGTTTTCCAGAACGGGAAAGG - Intergenic
1054560831 9:66708515-66708537 ATGGTGTTCCAGAGAGAGTATGG - Intergenic
1054694652 9:68348123-68348145 TTAATTTTCCAGGAAAAGAAGGG - Intronic
1054861607 9:69959488-69959510 TTGGTTTTGTAGACAGAAAAGGG + Intergenic
1055327550 9:75146903-75146925 TTGGTTTGCCAGTAAGTGACTGG + Exonic
1055349678 9:75373444-75373466 AGGGTTTTCCAAAAAGAGACTGG - Intergenic
1055485192 9:76749640-76749662 GAGGTTTTGCAGCAAGAGAAAGG - Intronic
1056348327 9:85722287-85722309 TTGGTGTTCCTGAAAGTGATGGG - Intronic
1056417561 9:86391503-86391525 TTGGTATACCAGAAAGTGATAGG + Intergenic
1056907272 9:90664405-90664427 TTGGTGTACCTGAAAGAGACAGG - Intergenic
1058527174 9:105871204-105871226 TTGCTTTAATAGAAAGAGAAAGG + Intergenic
1058818235 9:108705057-108705079 TTGGTTTTACAGCCAGAAAATGG - Intergenic
1058925993 9:109664806-109664828 TTGGTGTACCAGAAAGTGATGGG - Intronic
1059048800 9:110900276-110900298 TTGGCTTTGAAGAAAGAGGAAGG - Intronic
1059344362 9:113618134-113618156 TTGGTTTTACAGGATGAAAAAGG - Intergenic
1059532485 9:115048507-115048529 TAGGTTTTCCAGAAGGGGCAGGG + Exonic
1059967067 9:119625946-119625968 TTGGTGTACCAGAAAGTGATGGG - Intergenic
1060223908 9:121780055-121780077 TTGGTTTTTAATAAAGAGATGGG + Intronic
1060336747 9:122731065-122731087 TTGGTTTCCTTGAAAGAGATGGG + Intergenic
1061490601 9:130941905-130941927 TTGGTGAGCCAGAAAGAGGAAGG - Intergenic
1061521853 9:131122950-131122972 TTGGTCTTTCAGAAAGAAGATGG - Exonic
1061633854 9:131892826-131892848 TGGTTTTTCCAAAAAGAAAAAGG + Intronic
1203758103 Un_GL000218v1:155005-155027 TTGGTTTACCTGAAAGTGACAGG - Intergenic
1185857436 X:3549294-3549316 TTGGTTTTCCTGAAAGGCATGGG + Intergenic
1186026484 X:5319333-5319355 GTGGTTTTGCAGCAAGAGAAAGG + Intergenic
1186949360 X:14605944-14605966 TTGGTGGTCCACAAGGAGAATGG - Intronic
1187250536 X:17594209-17594231 ATGGTGTACCAGAAAGAGCATGG - Intronic
1187481785 X:19663317-19663339 TTGTTTTTTCAGGAAGAGTAGGG + Intronic
1188261510 X:28030413-28030435 TAGGTTCTCCAGACAGAGGATGG + Intergenic
1189280517 X:39817554-39817576 CTGGTTTCCCAGAAACAGGAGGG + Intergenic
1189557951 X:42164843-42164865 TTGGTGTTCCTGAAAGAGATGGG - Intergenic
1189855107 X:45215904-45215926 TTGGTGTACCTGAAAGAGATGGG + Intergenic
1189959160 X:46308075-46308097 TTTTTTTTCCAGATAAAGAAGGG + Intergenic
1189985165 X:46546864-46546886 GTGTTTATGCAGAAAGAGAAGGG + Intergenic
1190091958 X:47446455-47446477 TGGGATTTCCTGAAAAAGAATGG - Exonic
1190256422 X:48766119-48766141 TTGGACTTCCAGAGAGAGAATGG + Intronic
1190517343 X:51237289-51237311 TTAGAGTTCCAGAAGGAGAAGGG + Intergenic
1190615262 X:52223484-52223506 TTGGTGTTCCTGAAAGTGATGGG + Intergenic
1190899819 X:54659924-54659946 TGAGATTTCCAGAAAGAGAAAGG - Intergenic
1190977263 X:55417814-55417836 TTGGTGTACCTGAAAGAGATTGG + Intergenic
1190978144 X:55428049-55428071 TTGGTGTACCAGAAAGTGACAGG + Intergenic
1191075053 X:56443969-56443991 CTGGTTTCCCTGAAAGAGATGGG - Intergenic
1191747116 X:64501831-64501853 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1191751538 X:64548403-64548425 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
1191818595 X:65276231-65276253 TGGGTGTTTCAGAAAGAGAAGGG + Intergenic
1191942047 X:66491049-66491071 TTGGTTTACCTGAAAGTGATGGG + Intergenic
1192128828 X:68529094-68529116 TTGGTGTACCAGAAAGTGACAGG - Intronic
1192296994 X:69860843-69860865 TTGGTGTCCCTGAAAGAGATGGG - Intronic
1192917179 X:75665286-75665308 TTGGCATTCCTGAAAGAGAAGGG - Intergenic
1193176617 X:78401805-78401827 TTGGGTTTCCTGAAGGAGATGGG + Intergenic
1193231790 X:79056106-79056128 TTGGTGTACCTGAAAGTGAAAGG + Intergenic
1193315926 X:80065153-80065175 TTGGTGTACCTGAAAGTGAAGGG - Intergenic
1193514547 X:82447117-82447139 TTGGTGTACCTGAAAGAGACAGG + Intergenic
1193570069 X:83130175-83130197 TTGGTGTCCCTGAAAGAGAGTGG + Intergenic
1193571536 X:83151036-83151058 GTAGTTATCCAGAAAGAGTAGGG - Intergenic
1193582605 X:83284455-83284477 TTGGTGTACCAGAAAGTGATGGG - Intergenic
1193593705 X:83420631-83420653 TTTGTTTCCCTGAAAGAGATGGG + Intergenic
1193823746 X:86196785-86196807 TTGGTGTCCCTGAAAGAGATGGG + Intronic
1194103911 X:89743834-89743856 TTTGTTTTATAGAGAGAGAAAGG + Intergenic
1194137256 X:90161553-90161575 TTGGCATTCCTGAAAGAGAGGGG + Intergenic
1194140015 X:90197486-90197508 TTGGTGTACCAGAAAGTGATGGG + Intergenic
1194191107 X:90837733-90837755 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1194315129 X:92368110-92368132 TTGGTTTACCTGAAAGTGATGGG - Intronic
1194365594 X:93010111-93010133 TTGGCATCCCTGAAAGAGAAGGG - Intergenic
1194446084 X:93988286-93988308 TTGGATTACCTGAAAGAGATGGG + Intergenic
1194465798 X:94234217-94234239 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
1194550712 X:95295299-95295321 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1194635476 X:96341368-96341390 TTGGTGTACCTGAAAGAGATAGG - Intergenic
1194664025 X:96657222-96657244 ATGGTGTTCCTGAAAGAGATGGG + Intergenic
1194798233 X:98239449-98239471 TTGGTATACCTGAAAGTGAAGGG - Intergenic
1194830485 X:98617856-98617878 TTGGTGTACCTGAAAGAGATGGG - Intergenic
1195346554 X:103955669-103955691 TTGGTGTACCTGAAAGAGATGGG + Intronic
1195936872 X:110134023-110134045 TGGGTTTTCCTGAAAGAGGCAGG + Intronic
1195974788 X:110514756-110514778 TACTTTCTCCAGAAAGAGAAAGG - Intergenic
1196367661 X:114941831-114941853 TTGGTTTTCATGAAAGTGACAGG - Intergenic
1196584236 X:117410655-117410677 TTGGTGTTCCTGAAAGAGATGGG + Intergenic
1196758022 X:119174916-119174938 TTGGTTTTATAGACAGAAAAGGG + Intergenic
1197049739 X:122043996-122044018 CTGGTGTTCCTGAAGGAGAAGGG - Intergenic
1197522852 X:127521052-127521074 TTGGGGTACCAGAAAGAGAGAGG + Intergenic
1197736989 X:129858263-129858285 TTGGTGTACCTGAAAGAGACAGG - Intergenic
1197955667 X:131944821-131944843 GTGGTTTTGCAGAAAGAAATTGG - Intergenic
1198165191 X:134048784-134048806 TTGGTGTACCAGAAAGTGACGGG - Intergenic
1198166323 X:134061244-134061266 TTGGTGTACCAGAAAGTGACGGG - Intergenic
1198669569 X:139064787-139064809 TTGGTGTTCCTGAAAGTGACAGG - Intronic
1199137158 X:144266639-144266661 TTGGTATGCCTGAAAGAGATGGG + Intergenic
1199239990 X:145535361-145535383 CTGGTTCTCCAGAAAAAAAAAGG + Intergenic
1200269599 X:154669936-154669958 TTGGTGTACCAGAAAGTGACAGG - Intergenic
1200336402 X:155355226-155355248 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1200350068 X:155486001-155486023 TTGGTGTCCCTGAAAGAGATGGG - Intergenic
1200455864 Y:3391585-3391607 TTTGTTTTATAGAGAGAGAAAGG + Intergenic
1200482991 Y:3731477-3731499 TTGGCATTCCTGAAAGAGAGGGG + Intergenic
1200485760 Y:3766453-3766475 TTGGTGTACCAGAAAGTGATGGG + Intergenic
1200490541 Y:3817633-3817655 TTGGTGTCCCAGAAAAAGATGGG + Intergenic
1200537760 Y:4420148-4420170 TTGGTGTACCTGAAAGTGAAGGG + Intergenic
1200623181 Y:5479647-5479669 TTGGTTTACCTGAAAGTGATGGG - Intronic
1200673813 Y:6126361-6126383 TTGGCATCCCTGAAAGAGAAGGG - Intergenic
1200786026 Y:7261125-7261147 TGGGTTTTCCAGAAAAGGACTGG - Intergenic
1201229213 Y:11846854-11846876 TTGGTGTCCCTGAAAGAGATGGG + Intergenic
1201242769 Y:11974757-11974779 TGGGATTCCCAGAAGGAGAATGG - Intergenic
1201974914 Y:19838717-19838739 TTGGTTTACCTGAAAGTGACGGG - Intergenic
1202064517 Y:20924461-20924483 TTGGTTTACCTGAAAGTGATGGG - Intergenic
1202253836 Y:22900614-22900636 TTGGTGTACCTGAAAGAGATGGG - Intergenic
1202406826 Y:24534363-24534385 TTGGTGTACCTGAAAGAGATGGG - Intergenic
1202463955 Y:25135718-25135740 TTGGTGTACCTGAAAGAGATGGG + Intergenic