ID: 1180122990

View in Genome Browser
Species Human (GRCh38)
Location 21:45766310-45766332
Sequence CTCCAAAAGCAGTCATACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 348}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180122990_1180122998 3 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180122998 21:45766336-45766358 GGGCCCTTGGGAGGTGATTAAGG 0: 2
1: 26
2: 102
3: 213
4: 543
1180122990_1180123002 20 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180123002 21:45766353-45766375 TTAAGGTTACTGAGGTCATAAGG 0: 1
1: 5
2: 11
3: 34
4: 200
1180122990_1180122995 -10 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180122995 21:45766323-45766345 GCTTTTGGAGTCGGGGCCCTTGG 0: 1
1: 0
2: 0
3: 27
4: 221
1180122990_1180122996 -9 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180122996 21:45766324-45766346 CTTTTGGAGTCGGGGCCCTTGGG 0: 1
1: 0
2: 0
3: 16
4: 187
1180122990_1180123005 25 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180123005 21:45766358-45766380 GTTACTGAGGTCATAAGGGTGGG 0: 1
1: 2
2: 11
3: 176
4: 727
1180122990_1180122997 -6 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180122997 21:45766327-45766349 TTGGAGTCGGGGCCCTTGGGAGG 0: 1
1: 0
2: 16
3: 272
4: 1123
1180122990_1180123001 12 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180123001 21:45766345-45766367 GGAGGTGATTAAGGTTACTGAGG 0: 1
1: 0
2: 6
3: 38
4: 292
1180122990_1180123004 24 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180123004 21:45766357-45766379 GGTTACTGAGGTCATAAGGGTGG 0: 1
1: 2
2: 8
3: 130
4: 645
1180122990_1180123003 21 Left 1180122990 21:45766310-45766332 CCCTAGTATGACTGCTTTTGGAG 0: 1
1: 0
2: 5
3: 43
4: 348
Right 1180123003 21:45766354-45766376 TAAGGTTACTGAGGTCATAAGGG 0: 1
1: 4
2: 7
3: 28
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180122990 Original CRISPR CTCCAAAAGCAGTCATACTA GGG (reversed) Intronic
900793841 1:4695814-4695836 CTCCGAATGCAGTCACACCAAGG + Intronic
900798919 1:4725929-4725951 CTCCAAATACAGTCACATTAGGG + Intronic
901863023 1:12086897-12086919 CTCCAAATACAGTCACACTGGGG + Intronic
902445890 1:16463994-16464016 CTCCAAATACCATCATACTAGGG + Intergenic
904352301 1:29916471-29916493 CTCCAAATACAGTCACACTGGGG + Intergenic
904946083 1:34199705-34199727 CTCCCAATGCAGACATACTTTGG - Intronic
904971288 1:34421276-34421298 CTCCAAATACAGTCATATTGGGG - Intergenic
906659526 1:47572691-47572713 CTCTAAAAACAGTAAGACTAAGG - Intergenic
907620878 1:55978274-55978296 CTCCAAATACAGTCACATTAAGG - Intergenic
908964485 1:69741649-69741671 CTCCAAAAGTATTCAGAATAGGG + Intronic
909071379 1:70997835-70997857 GTCTCAAAACAGTCATACTATGG - Intronic
909260058 1:73476343-73476365 TTCCAAAACCAGTCTTTCTAGGG - Intergenic
909597872 1:77426970-77426992 CACCAAAAGCAGTGATAATGGGG + Intronic
909870051 1:80728063-80728085 CTCCAAATACAGTCACATTAGGG + Intergenic
911818263 1:102382757-102382779 CTCCAAATGCCATCATATTAGGG + Intergenic
912035930 1:105313528-105313550 CTCCAGAAGCAATCATTATAAGG + Intergenic
912600727 1:110930641-110930663 CTCCAAATACAGTTATACTGGGG + Intergenic
912633435 1:111269245-111269267 CTCCAAATACAGTCACACTGTGG - Intergenic
913969611 1:143404790-143404812 CTCCAAATTCAGGCATACCATGG - Intergenic
914839202 1:151233818-151233840 CTCCAATAGCAATCAGAGTAAGG - Intronic
916194599 1:162211480-162211502 CTCCAAATGCAGTCACATTGGGG + Intronic
918586494 1:186194282-186194304 CTCCAAATGCAGTCACATTGAGG - Intergenic
921249704 1:213285327-213285349 CTCCTAATGCTGTCATACTGGGG + Intergenic
921337329 1:214101294-214101316 CTCCAAATACAGTCACACCAGGG + Intergenic
921441902 1:215197586-215197608 CTCCAAATGCAGTCACACTGGGG + Intronic
921890103 1:220344993-220345015 ACCTAAAAGCAGTCATACCATGG + Intergenic
922441436 1:225658330-225658352 CTCCAAAACCATTCAGGCTATGG - Intergenic
922708748 1:227809969-227809991 CACCAAAAGCAGTCCTAAAAGGG + Intergenic
923142305 1:231171057-231171079 CTCTAAAAGCAGTCCCATTAGGG - Intronic
924818879 1:247468840-247468862 CTCCAGATGCAGTCACACTGGGG - Intergenic
1062904261 10:1169429-1169451 CTTCAAAGGAAGTCATACCAGGG - Intergenic
1063386634 10:5620189-5620211 CTCCAAAGCCAGTCATAACAAGG - Intergenic
1063879628 10:10517781-10517803 GTCCAAAAGCAATCCCACTATGG + Intergenic
1063997603 10:11635107-11635129 CTCCAAAAACAGTCATACTGAGG + Intergenic
1065500391 10:26375853-26375875 CTCCAAATATAGTCATACTAGGG - Intergenic
1066117080 10:32249988-32250010 CTCCAAATACAGTCACACTGGGG + Intergenic
1067364525 10:45612756-45612778 CTCCAAATACAGCCACACTAGGG - Intergenic
1068789439 10:61010939-61010961 CTCCAAATACAGTCATATTTGGG - Intergenic
1068939796 10:62669610-62669632 CTCCAAATACAGTCATATTGGGG + Intronic
1069576893 10:69537077-69537099 CTCCAAATACAGTCACATTAGGG + Intergenic
1070112597 10:73499286-73499308 CTCCAAGAGCATACATACAAGGG + Intronic
1070152356 10:73812479-73812501 CTCCAACAGCAGTAACACAATGG + Exonic
1070590763 10:77799317-77799339 CTCCAAAGGTAGTCACACTGGGG - Intronic
1071125306 10:82328022-82328044 CTCCAAAAACAGTCACATTGCGG + Intronic
1071184998 10:83032664-83032686 CTCCAAAAACAGTCACATTGGGG + Intergenic
1072758021 10:98033438-98033460 CTCCAAATGCAGTCACACTAAGG - Intergenic
1073857859 10:107697959-107697981 CTTCTAAACCAGTCATATTAGGG + Intergenic
1075448094 10:122527841-122527863 CTGCAACAGCAGTCATCCTGGGG - Intergenic
1076193796 10:128500689-128500711 CTCCAAACGCAGAAATACTAGGG - Intergenic
1076935191 10:133564110-133564132 CTCCTAATGCAGTCACACTAGGG - Intronic
1077051814 11:569934-569956 CTCCTAGGGCAGTCAGACTAGGG + Intergenic
1077128713 11:958057-958079 CTCCAAATCCAGTCACACTGGGG - Intronic
1078397564 11:10994783-10994805 CTCCAAATACAGTCACATTAGGG - Intergenic
1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG + Intergenic
1079373198 11:19869769-19869791 TTCAAAAAGCAGTCTCACTAGGG - Intronic
1081268923 11:41060640-41060662 CTCCAAATACAGCCATACTGGGG + Intronic
1081417757 11:42836154-42836176 CTCCAAAAACAGTCACACTGGGG + Intergenic
1081469891 11:43359534-43359556 GTCCAGAAGCTGTCATACCATGG - Intronic
1082722401 11:56694461-56694483 CTCCAAATGAAGTCACACTGGGG + Intergenic
1083974697 11:66108392-66108414 CTCCAAATGCAGTCACTTTAGGG + Intronic
1084699708 11:70778466-70778488 CTCCAAATCCAGTCACACTGAGG - Intronic
1085536814 11:77226304-77226326 CTCCAAATACAGTCACACTGAGG - Intronic
1086219790 11:84428694-84428716 CTCCAAATACAGTCACACTGAGG + Intronic
1087215474 11:95488517-95488539 CTCCAAATACAGTCACATTAGGG - Intergenic
1089672198 11:120064269-120064291 CTCCAAATGCAATCATACTGGGG - Intergenic
1090073517 11:123564128-123564150 CTCAAGAGGCAGTCAGACTAAGG - Intronic
1090099182 11:123776044-123776066 CTCTAAAAGCAATCATTCTTTGG + Intergenic
1091057624 11:132433627-132433649 CTCCAAATACAGACATACTGGGG - Intronic
1092495285 12:8987230-8987252 CTCCAAATACAGTCACACTGAGG - Intronic
1093412125 12:18879502-18879524 CTCCAAATACAGTCACACTCTGG + Intergenic
1094013345 12:25832715-25832737 CTCCAAAATCTGTCATCCTGGGG + Intergenic
1095895109 12:47272210-47272232 CTGTAAAAGCAGTCATTCCAGGG + Intergenic
1098954262 12:76672058-76672080 CTCCAAATACAGTCACACTGAGG - Intergenic
1099787844 12:87289074-87289096 CTCCAAATACAGTCACATTAGGG - Intergenic
1101638347 12:106566322-106566344 CTCCAAATACAGTCACACTGGGG - Intronic
1102348543 12:112175196-112175218 CTCCAAATGTAGTCACACTGGGG - Intronic
1104231552 12:126889435-126889457 ATCCAAAGGCATTCATTCTAAGG + Intergenic
1105321387 13:19325436-19325458 TTCTAAAAGCAGTTATACAAAGG + Intergenic
1106110629 13:26773465-26773487 CTCCAAATACAGCCATACTGAGG + Intergenic
1106965740 13:35064635-35064657 CTCCAAAAACAGTCAGATTACGG - Intronic
1107410574 13:40154220-40154242 CTCCAAATACAGTCATATTGGGG + Intergenic
1108363252 13:49686665-49686687 CAGCAAAAGCAGTCATACCTGGG + Intronic
1108900079 13:55391723-55391745 CTCTAAAAACAATCATATTAGGG - Intergenic
1109056218 13:57552438-57552460 CTCCAAAAATAGCCACACTAGGG + Intergenic
1110225025 13:73110728-73110750 CTCCAAAATCAGGAATACCAGGG + Intergenic
1110727599 13:78843284-78843306 CTCCAAATACAGTCATATTAGGG + Intergenic
1110970580 13:81756516-81756538 CTCAGAAAGCAGTAATATTAAGG - Intergenic
1111320000 13:86614713-86614735 CTCCAAATGCCATCATACTGGGG - Intergenic
1112248213 13:97753905-97753927 CTCCAAATGCAGTCACATTGTGG + Intergenic
1113164718 13:107426446-107426468 CTCTAACAGCAGTCATATGAAGG - Intronic
1114129424 14:19772840-19772862 CTTAAAAATCAGTCATACTATGG - Intronic
1118085591 14:62412389-62412411 CTCCAAAGACAATCAAACTAGGG - Intergenic
1119579517 14:75764609-75764631 CTCCATCAGCAGTCATTCTAGGG - Exonic
1120024828 14:79571002-79571024 CTCCAAATTCAGCCATATTAGGG + Intronic
1120126554 14:80750863-80750885 CTCCAAATACAGTCACACTTGGG - Intronic
1123572383 15:21627074-21627096 CTTAAAAATCAGTCATACTATGG - Intergenic
1123608998 15:22069661-22069683 CTTAAAAATCAGTCATACTATGG - Intergenic
1124584654 15:30993378-30993400 CTCCAAATGTAGCCATACCAGGG + Intergenic
1126466981 15:48969774-48969796 CTCCAAAGGCAGTAACAGTAGGG - Intergenic
1126789323 15:52206431-52206453 CTCCAAATACAGCCACACTAGGG - Intronic
1127484064 15:59403257-59403279 CTCCAAATACAGTCATATTGGGG - Intronic
1127571790 15:60250762-60250784 CTCCAAACACAGTCACATTAAGG + Intergenic
1128877143 15:71211582-71211604 CTCCAAATACAATCATACTGAGG + Intronic
1129478873 15:75807353-75807375 CTCCAAATGCAGCCATACAGAGG - Intergenic
1130162841 15:81418810-81418832 CTCCAAATACAGTCATATTGTGG - Intergenic
1131539415 15:93263609-93263631 CTCCAAATACAGTCTTATTAGGG + Intergenic
1132256767 15:100383163-100383185 CTGCAAAAGCAGACACACTGGGG - Intergenic
1202981239 15_KI270727v1_random:361461-361483 CTTAAAAATCAGTCATACTATGG - Intergenic
1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG + Intronic
1133716672 16:8456910-8456932 CTTCAAAAGAAGACATACAAAGG + Intergenic
1135739236 16:24959285-24959307 CTCCAAGAGCATCCATTCTAGGG - Intronic
1137814997 16:51390084-51390106 CTCCAAATGCAGTTATATTGGGG + Intergenic
1137931428 16:52591461-52591483 CTCCAAACGCATTCATTCCATGG + Intergenic
1138142624 16:54581950-54581972 CTCCAAATACAATCATATTAGGG + Intergenic
1138231173 16:55337559-55337581 CTCCAAATACAGTCACATTAGGG + Intergenic
1138931600 16:61665039-61665061 CTCCAAATGCAGGCAAACTGAGG - Intronic
1139295421 16:65896246-65896268 CTTCAAAAGCACTCTTACAATGG - Intergenic
1139617162 16:68104264-68104286 CTCCAAAAGAAATAATACTCAGG - Intronic
1139974323 16:70796829-70796851 CTCCAAATCCAGTCACACTGTGG - Intronic
1141023736 16:80523210-80523232 CTCCAAATCCAGTCACACTGGGG + Intergenic
1141062331 16:80884903-80884925 CTCCAAATGCAGTCACATTGAGG + Intergenic
1141906232 16:87028809-87028831 CTGCAAAACCAGTCTGACTACGG + Intergenic
1143099187 17:4495981-4496003 TTCAAAGAGCAGTCATACTTGGG - Intergenic
1143179859 17:4977784-4977806 CTCAAAAATCAGCCTTACTAGGG - Intronic
1144208907 17:12998635-12998657 CTCCCAAAACCGCCATACTAGGG - Intronic
1144287976 17:13798102-13798124 CTCCAAATGCAGTCACACTGGGG - Intergenic
1146280424 17:31540998-31541020 CTCCAAATACAGTCACACTGGGG + Intergenic
1147839761 17:43362855-43362877 ATCCAAAAGCAGTCCGACTCTGG + Intergenic
1148965258 17:51429562-51429584 CTCCAAATGTAGTCACACTGGGG + Intergenic
1149621951 17:58052195-58052217 CTCCAAATAGAGCCATACTATGG + Intergenic
1153434933 18:5059026-5059048 CTCCAAATACAGCCATACAAGGG - Intergenic
1153762610 18:8346522-8346544 CTCCAAATACAGTCACACTTGGG + Intronic
1155233409 18:23795875-23795897 CTCCAAATACAGTCACACTGGGG - Intronic
1155939709 18:31791059-31791081 CTCCAAATACAGTCACATTAGGG - Intergenic
1156536396 18:37868723-37868745 CTCCAAATACAGCCATACTGGGG + Intergenic
1158652665 18:59301462-59301484 CTCCAGAAGCAGCCATGCTCTGG - Intronic
1159150578 18:64518252-64518274 CTCCAAATGCAGTCACATTCTGG + Intergenic
1160437184 18:78860598-78860620 CTCAAATAACTGTCATACTAGGG - Intergenic
1162150773 19:8644062-8644084 CTCCAAATTCAGTCACACTGGGG - Intergenic
1163338452 19:16688593-16688615 CTCCAAAAGCTGTGACTCTATGG - Exonic
1163433788 19:17283272-17283294 CTCCAAAAGCAGCCATGCAGAGG + Exonic
1164326377 19:24196171-24196193 CACCAAAAGCAGTCAAACGTTGG - Intergenic
1164961548 19:32435279-32435301 CTCCAAGAACAGTCATATTAGGG + Intronic
1165171715 19:33897031-33897053 CTCCAAATACAGTCACACTGGGG - Intergenic
1202646430 1_KI270706v1_random:146161-146183 CACCAAATGCATTCTTACTATGG - Intergenic
925144430 2:1571458-1571480 CCCCAAATGCAGTCATCCTGGGG + Intergenic
925721584 2:6833598-6833620 CTCCAAATGCAGCCACTCTAGGG + Intergenic
925822900 2:7817988-7818010 CTCCAAATACAGTCACATTAGGG + Intergenic
926109714 2:10174014-10174036 CTCCAAATGCAGCCACACTGGGG - Intronic
926384643 2:12324114-12324136 CTCCAAATACAGTCACACTGGGG + Intergenic
927257469 2:21052532-21052554 CACCAAAAGCAATCATTCCAAGG - Intergenic
927423403 2:22955890-22955912 CTCCAAATACAGTCATAGTGGGG + Intergenic
928092931 2:28387058-28387080 CTCCAAGGGCAGCCCTACTATGG - Intergenic
928246394 2:29632342-29632364 CTCCAAATACAATCATACTGGGG - Intronic
928275448 2:29896384-29896406 CTCCAAATGCAGTCACATTGGGG - Intronic
929034902 2:37681290-37681312 CTCCAAATACAGTCATTTTAAGG - Intronic
929142124 2:38675917-38675939 CTCCAAAAGCAGCCATACTTTGG + Exonic
930242545 2:48951321-48951343 GTCCAAAAGCAGTCATCTCAGGG - Intergenic
930304607 2:49662935-49662957 CTCCAAAAGGAGATATATTAAGG + Intergenic
931128017 2:59299042-59299064 CTCCAAATGCAGTCACAGTGGGG - Intergenic
932020314 2:68077937-68077959 CTCCAAATGCAGTCACATTGAGG + Intronic
932825487 2:74935126-74935148 CTCCAAATACAGTCATATTGGGG - Intergenic
932989199 2:76765453-76765475 CTCCAAATGTAGCCATACTGAGG - Intronic
933184331 2:79261746-79261768 CTCCAAATGCAGTCACATCAGGG + Intronic
933999505 2:87695784-87695806 CTGCCAAAGCAGTCAGACAACGG + Intergenic
934031020 2:88046929-88046951 CTCCCAAAGCAGTGGGACTATGG + Intronic
934509571 2:94926601-94926623 CACCAAATGCATTCGTACTATGG - Intergenic
934569871 2:95362499-95362521 CTCCAAATACAGTCACACTGGGG + Intronic
935004721 2:99061789-99061811 CTCCAAATATAGTCACACTAGGG - Intronic
935206211 2:100898308-100898330 CTCCCAAAGCAATGATATTATGG + Intronic
935301031 2:101694157-101694179 CTCCAAACACAGCCACACTAGGG - Intergenic
935322435 2:101902145-101902167 CTCCAAGTGCAGTCACACTGGGG - Intergenic
935660795 2:105465243-105465265 CTCCAAATACAGTCATACTGGGG + Intergenic
935985884 2:108672692-108672714 CTTAAAAATCAGTCATATTAGGG + Intronic
936138315 2:109916319-109916341 CTTAAAAATCAGTCATATTAGGG + Intergenic
936206381 2:110455166-110455188 CTTAAAAATCAGTCATATTAGGG - Intronic
936294350 2:111255107-111255129 CTGCCAAAGCAGTCAGACAATGG - Intergenic
936946983 2:117939993-117940015 CTCTAAAAGCTGTAATACTTAGG - Intronic
937547695 2:123043965-123043987 CTCCAAATACAGTCATGCTGGGG + Intergenic
939093715 2:137808164-137808186 CTCCAAATACAATCATACTGAGG + Intergenic
939332991 2:140788789-140788811 CTCCAAATACAGTCACACTGAGG - Intronic
941220086 2:162767485-162767507 CTCCAATAGCAGTAAAACTATGG - Intronic
941939384 2:171018069-171018091 CTTCAAATGCAGCCATATTAGGG - Intronic
944233197 2:197416378-197416400 CTCCAAATACAGTCACACTGGGG - Intronic
945558189 2:211305125-211305147 CTCCAAATACAGTCACACTGGGG + Intergenic
945626191 2:212209642-212209664 CTCCAAATGTAGTCACTCTAAGG - Intronic
946881271 2:224179574-224179596 CTCCAAATGCTGTCACACTGGGG + Intergenic
948102964 2:235390042-235390064 CTCCAAATGCAGTCACATCAGGG + Intergenic
1169451216 20:5713239-5713261 CTCCAAACACAGTCATATTGTGG - Intergenic
1169533516 20:6511732-6511754 CCACAAAAGCAGTCATAACAAGG - Intergenic
1169938750 20:10914230-10914252 CTCCAAATACAGTCACACTGAGG - Intergenic
1170419697 20:16180612-16180634 CTCCAAATGCAGCCACACTAGGG + Intergenic
1170504332 20:17009132-17009154 CTCCAAATGCAGTCACATTAGGG + Intergenic
1170658081 20:18309202-18309224 CTCCAAATACAGTCACATTAGGG + Intronic
1172298441 20:33830702-33830724 CTCCAAATGCAGCCACACTGGGG + Intronic
1173525988 20:43733051-43733073 CTCCAAAATCAGTCACATTGAGG - Intergenic
1174971638 20:55282463-55282485 CTCCAAATACAGTCACTCTAGGG + Intergenic
1175410937 20:58768660-58768682 CTCCAAAAGCAGCAATTCTTGGG + Intergenic
1176425265 21:6544789-6544811 CTCCAAATACAGTCACACTGGGG + Intergenic
1176605441 21:8826596-8826618 CACCAAATGCATTCTTACTATGG + Intergenic
1177022887 21:15885073-15885095 CTCCAAACACAGTCATGTTAGGG + Intergenic
1177521477 21:22233377-22233399 CTCCAAATATAGTCATATTAGGG - Intergenic
1178014781 21:28331803-28331825 CTCTAAATACAGCCATACTAGGG - Intergenic
1178223374 21:30686213-30686235 CTCCAAATACAGTCATATTAGGG + Intergenic
1179700756 21:43153106-43153128 CTCCAAATACAGTCACACTGGGG + Intergenic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
1180154075 21:45969548-45969570 CTCCAAATGCACTCACATTAGGG - Intergenic
1180347736 22:11718201-11718223 CACCAAATGCATTCTTACTATGG + Intergenic
1180355512 22:11836306-11836328 CACCAAATGCATTCTTACTATGG + Intergenic
1180382740 22:12156019-12156041 CACCAAATGCATTCTTACTATGG - Intergenic
1180641408 22:17302379-17302401 CTCCAAATGCAGTCACATTGAGG - Intergenic
1181996473 22:26886742-26886764 CAGCAAAAGCAGTCATAGAATGG - Intergenic
1183046246 22:35222771-35222793 CTCCAAATACAGTCACATTAGGG - Intergenic
1184492383 22:44817202-44817224 CTCCCAAAGCTGTCATTCCAGGG + Intronic
1184543675 22:45150213-45150235 CTCCAAATGAAGTCACACTGGGG - Intergenic
1185163891 22:49245862-49245884 CTCCAAATACAGTCAAACTGGGG + Intergenic
949091538 3:34990-35012 CTCCAAATACAGTCATATTGGGG - Intergenic
949365434 3:3275433-3275455 CTCCAAATGCAGTAGTGCTAAGG - Intergenic
949734503 3:7156066-7156088 CTCTAAAAGCAATGATATTAGGG + Intronic
950884772 3:16353620-16353642 CTCCAAATACAGCCAAACTAGGG - Intronic
952333737 3:32387249-32387271 CTCCAAATACAGTCACACTTGGG - Intergenic
953535999 3:43777228-43777250 CTCCAAAAGCAGTAATGACAGGG - Intergenic
953546271 3:43865695-43865717 CTCCAACAGCAGGTATACTCCGG - Intergenic
954806126 3:53221929-53221951 CTCCAAATACAGTCACATTAGGG - Intergenic
955459229 3:59162103-59162125 CTCCAAATACAGTCATATTAGGG - Intergenic
955615873 3:60805899-60805921 CTCCAAATACAGTCACATTAGGG + Intronic
955979761 3:64512961-64512983 CTCCAAATACAGTCACATTAGGG - Intergenic
956144692 3:66180833-66180855 CTCCAAATACAGTCACACTGGGG - Intronic
956192867 3:66623619-66623641 CTCCAAATACTGTCATACTTGGG + Intergenic
956408462 3:68953432-68953454 CTTTGAAAGCAGTCATTCTAAGG - Intergenic
957655225 3:83065275-83065297 CTCCAAATACAGTCACACTGGGG + Intergenic
957679635 3:83417368-83417390 CTCCAAATACAGTCACACTGGGG - Intergenic
957881559 3:86220428-86220450 CTTCAAAAGCCTTCACACTATGG - Intergenic
959131013 3:102356028-102356050 CTCCAAATTCAGTCACACTGGGG + Intronic
961047010 3:123716035-123716057 CTCCAAACCCTGTTATACTATGG + Intronic
962682052 3:137810516-137810538 CTCCAAATACAGTCACACTGGGG - Intergenic
963081143 3:141394661-141394683 CTCCACAGGCACTCAGACTAGGG - Intronic
964681578 3:159345865-159345887 CTCCAAAACCATTAATAGTATGG + Intronic
964964318 3:162472172-162472194 TTCCAAAAGCACTTTTACTAAGG + Intergenic
965708965 3:171537294-171537316 CTCCAAATACAGTCACACTGGGG + Intergenic
966535877 3:181033082-181033104 CTCCAAATACAGTCATATTGGGG + Intergenic
967911218 3:194544161-194544183 CTCCAGAAACAGCCATACTGAGG - Intergenic
968791081 4:2662578-2662600 CTCCAAAAGTAGAAATATTAAGG - Intronic
969698292 4:8748287-8748309 CCCCAAAAGTGGTCATAATAAGG + Intergenic
969854960 4:9991612-9991634 CCCCAAATGCAGTCACATTAGGG - Intronic
971305832 4:25480470-25480492 CACCAAAAGCTGTCATAGTCAGG - Intergenic
972381122 4:38521454-38521476 CTCCAAATAAAGTCATACTGAGG - Intergenic
972864306 4:43211493-43211515 CTCCAGAAACAGTAAAACTAAGG + Intergenic
973372658 4:49264308-49264330 CACCAAATGCATTCTTACTATGG - Intergenic
973388334 4:49530752-49530774 CACCAAATGCATTCTTACTATGG + Intergenic
974270400 4:59643963-59643985 CTCCAACAGTAGTGATAATAAGG - Intergenic
974822105 4:67080477-67080499 CTCCAAATGCAGTCACAATGGGG + Intergenic
975312534 4:72918583-72918605 TTCCAAAGACAGTCACACTAGGG - Intergenic
975467538 4:74725193-74725215 TTCCAGAATGAGTCATACTACGG - Intergenic
975836796 4:78431116-78431138 CTCTAAAAGGAATCATACAAAGG - Intronic
975994669 4:80300743-80300765 CTCCAAATACAGTTATATTAGGG - Intronic
976857384 4:89620999-89621021 CTCCAAAAACAGGCATACAGTGG + Intergenic
979480499 4:121210819-121210841 CTCCAAATGCAGTCACATTGGGG + Intronic
979672086 4:123370750-123370772 CTCCAAATACAGTCATATTGGGG - Intergenic
979704300 4:123703278-123703300 CTCCAAATACAGTCATATTGGGG - Intergenic
980975207 4:139604572-139604594 CTCCAACTACAGTCACACTAGGG - Intronic
981299964 4:143175926-143175948 CACCAAAAGCAGTCCTAAAAGGG - Intergenic
982808960 4:159802551-159802573 CTCCAAATACAGTCACACTGGGG - Intergenic
985518983 5:362039-362061 CTCCAAATACAGCCAAACTAGGG - Intronic
986274445 5:6261193-6261215 CTCCAAATACAGTCATAGTCTGG + Intergenic
986463108 5:7993441-7993463 CTCCAAATATAGTCATATTAGGG + Intergenic
986647393 5:9930699-9930721 CTCCAAATACAGTCACACTAGGG + Intergenic
986980107 5:13437584-13437606 CTCCAAATGCAGTCACATTATGG + Intergenic
987888156 5:23837934-23837956 CTCCAAATACAGTCACATTAGGG - Intergenic
989713463 5:44429831-44429853 ATCTAAAAACTGTCATACTAGGG - Intergenic
989756238 5:44958954-44958976 CTCCAAATGCAGTCATATTGAGG - Intergenic
989995799 5:50829052-50829074 CTCTAAAAGCATTCATATTGAGG - Intronic
990910698 5:60849486-60849508 CTCCAAAAGCAGGCATATCCAGG - Intergenic
991443389 5:66675117-66675139 CTCCAAACGCAGTCCTACATAGG + Intronic
993631392 5:90290141-90290163 CTCCAAACACAGTCACATTAGGG + Intergenic
993943772 5:94094437-94094459 CTCCAAATGCAATCATATTGGGG + Intronic
994577551 5:101598173-101598195 CTGCAAAAGCAGTCTTAAGATGG + Intergenic
995855766 5:116590494-116590516 TTCCAAATGCAGCCATACTGGGG - Intergenic
997230693 5:132240168-132240190 CTCCAAATGCAGTCACATTTAGG - Intronic
997786972 5:136722465-136722487 CTCCAAATACAGTCACACTAGGG + Intergenic
997806877 5:136926948-136926970 CTCCAAATACAGTCATATTGGGG - Intergenic
998638541 5:143983994-143984016 CTCCAAAGACAGTCACACTGGGG + Intergenic
999019834 5:148153175-148153197 CTCCAAATACAGTCACATTAGGG + Intergenic
999130104 5:149275899-149275921 CTCCAAATACAGTCACACTTGGG + Intronic
999469473 5:151839592-151839614 CTCCAAATACAGTCATAATGGGG - Intronic
999840360 5:155418496-155418518 CTCCAAATACAGTCACATTAAGG + Intergenic
999878072 5:155830437-155830459 CTCCAAATGCAGTCATTTTATGG + Intergenic
999946599 5:156603565-156603587 TTGCAAAAGCAGTCATAAGAAGG - Intronic
1000724008 5:164745805-164745827 CTCCTAATACAGTCATACTGGGG + Intergenic
1001833583 5:174810652-174810674 CTCCAAACACAGTCACATTAGGG + Intergenic
1002105490 5:176877671-176877693 CTCAAAAAGCAGTCGTGCGAGGG + Exonic
1002833312 6:843795-843817 CTCCAAATACAGTCACATTAGGG + Intergenic
1003848477 6:10198161-10198183 ATCCAAAAGCAGCCAACCTATGG - Intronic
1004038623 6:11951191-11951213 CTCCAAATACAGTCACACTGGGG + Intergenic
1004981404 6:21028651-21028673 CTCCAAATACAGTCACACTGGGG + Intronic
1005467555 6:26130242-26130264 GTCCAAATGCAGTCACACTGGGG + Intronic
1007142796 6:39592757-39592779 CTCCAAAACCAACCATACTCTGG + Intronic
1008644070 6:53495453-53495475 CTCCAAATACCCTCATACTAGGG - Intergenic
1008779574 6:55086698-55086720 CTCCAAATACAGTCACATTAGGG - Intergenic
1009584421 6:65579756-65579778 CTCCAAATATAGTCACACTAAGG + Intronic
1010361719 6:75003113-75003135 TTACAAAAGCAGTCAAACTAGGG + Intergenic
1010554085 6:77257748-77257770 CTCCAAATGCAGTCACACTGGGG + Intergenic
1010862154 6:80926284-80926306 CTCCAAATGCAGTCATATTAGGG - Intergenic
1011324977 6:86140663-86140685 CTCCAAATGCAGTCATATTGGGG + Intergenic
1011349351 6:86405446-86405468 CTCCAAATGCAGTCACACCAAGG - Intergenic
1012143181 6:95649397-95649419 CTCCAAAAGCACTAATACAAAGG + Intergenic
1012298617 6:97555986-97556008 CTGAAACAGCAATCATACTATGG + Intergenic
1012695780 6:102381650-102381672 CTCCAAACACAGTCACACTGGGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013612585 6:111808691-111808713 CTTCAAAAGCAAGCATACCAGGG + Intronic
1013655155 6:112238969-112238991 CTCCAAATACAGTCACATTAGGG - Intronic
1014976015 6:127885037-127885059 CTTCTAATGCAGTCACACTAGGG + Intronic
1015793249 6:136985463-136985485 CTCCAAATACAGTCACATTAAGG - Intergenic
1015842024 6:137487466-137487488 CTCCAAAAGAAGTAATGCCAAGG + Intergenic
1016134634 6:140524438-140524460 CTCCAAATACAGACATACTGAGG + Intergenic
1016431964 6:143994741-143994763 CTCCAAATACAGTCACATTAGGG - Intronic
1019073264 6:169366975-169366997 CTCCAAACTCAGTCACACTGAGG - Intergenic
1019085209 6:169469047-169469069 ATCCAAACACAGTCATACTGGGG + Intronic
1021244371 7:18243977-18243999 CTCCCAAAGCAGATAAACTATGG + Intronic
1027028342 7:74870719-74870741 CTCCCAAAGCACTCAGATTATGG + Intergenic
1027459922 7:78439478-78439500 CTCCAAATGCTGTCATACAAAGG - Intronic
1028012643 7:85667745-85667767 CTTCAAACGCTGTCATACTGGGG - Intergenic
1029007423 7:97225409-97225431 CTCCAAAGACAGTCACACTGGGG + Intergenic
1029729709 7:102431442-102431464 CTCAAAAAGCAATCATGTTATGG - Intergenic
1029955483 7:104634467-104634489 CTCCAAATACAGTCACATTAGGG + Intronic
1030177204 7:106666947-106666969 CTCCAAATACAGTCACACTGGGG - Intergenic
1030923549 7:115422184-115422206 CTCCAAATGCAGTTACAATATGG - Intergenic
1031576823 7:123424423-123424445 CTCCAAATATAGTCATATTAGGG + Intergenic
1033797182 7:144860127-144860149 CTTCAAAAGCAATCTTATTAAGG + Intergenic
1034572073 7:151964255-151964277 CTCCAAATGCAGTCGCACTGGGG + Intronic
1035097979 7:156371522-156371544 CTCCAAATACAGCCATACTGTGG + Intergenic
1035825435 8:2639809-2639831 CTCCAAAACCAGTCAGACTGGGG - Intergenic
1036114349 8:5942212-5942234 TTCCAAATGCAGTCACACTGGGG + Intergenic
1036190662 8:6667074-6667096 CTCCACATACAGTCACACTAGGG + Intergenic
1037450422 8:19011352-19011374 CTCCAAAAGTAGTAGTACCATGG + Intronic
1037660831 8:20925423-20925445 CTCCAAATACAGTCATATTTTGG + Intergenic
1037771806 8:21805613-21805635 CTACATGAGCAGTCAAACTAGGG + Intronic
1038529294 8:28304662-28304684 CTCCAAACACAGTCACACTAGGG + Intergenic
1040541597 8:48362059-48362081 CTCCAAATGCAGCCACACTGGGG + Intergenic
1041522271 8:58769648-58769670 CTCCAAATACAGTCACACTGGGG + Intergenic
1041627264 8:60044795-60044817 CTCCAAATACAGTCACACTGGGG - Intergenic
1042091110 8:65160864-65160886 CACCAAAAGCAGCCATGCTCCGG - Intergenic
1042456699 8:69013658-69013680 CTCCAAAGACAGTTATACTGGGG - Intergenic
1042653105 8:71065212-71065234 CTCCAAATGCAGTCACATTGGGG - Intergenic
1042702038 8:71625900-71625922 CACCAAAAACAGTCACACTGGGG - Intergenic
1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG + Intergenic
1043141262 8:76593138-76593160 CTCCAAATACAGTCATATTGGGG + Intergenic
1043289250 8:78576129-78576151 CTCCAAATGCAGTCACACTGAGG + Intronic
1043771395 8:84206095-84206117 CTCCAAATGCAGACATATTCTGG + Intronic
1043984597 8:86679398-86679420 CTCCAAATTCAGTCACATTAGGG - Intronic
1044022521 8:87123510-87123532 CAGCAAAAGCAGTCCTAATAAGG + Intronic
1044642357 8:94396761-94396783 CTCCAAAAACAGTCACATTGGGG - Intronic
1045687690 8:104728482-104728504 CTCCAAATGCCGTCATATTGGGG + Intronic
1045793868 8:106020104-106020126 CTCCAAATACAGTCATATTGGGG - Intergenic
1046120680 8:109842555-109842577 CTCCAAATTCAGTCACACTAGGG - Intergenic
1046304692 8:112349908-112349930 CTCCAAATACAGTCACATTAGGG - Intronic
1046424934 8:114034953-114034975 GTCCAATATCAGACATACTATGG + Intergenic
1046615940 8:116477420-116477442 CTCCAAATACAGTCACACTGGGG - Intergenic
1047894063 8:129345393-129345415 CTCCAAATGCAATCACACTGGGG + Intergenic
1048128816 8:131668868-131668890 CTCCAAATACAGTCATACTGGGG + Intergenic
1049117087 8:140698235-140698257 GTCCAAATGCAGTCATACGTGGG + Intronic
1049156681 8:141071483-141071505 CTCCAAGCACAGTCATACTGGGG + Intergenic
1050072188 9:1827027-1827049 CTCCAAACACAATCATACTGGGG - Intergenic
1050114047 9:2244753-2244775 CTCCAAATACAGTCACATTAGGG - Intergenic
1050385751 9:5088886-5088908 CTCCAAATACAGTCATATTGGGG + Intronic
1050687086 9:8183913-8183935 CTCCAAATGCAGTAATATTGAGG + Intergenic
1051164428 9:14246838-14246860 CTCCAAATGCAGTTACACTGGGG - Intronic
1051488065 9:17630076-17630098 TTCCAAAAGCAGTGATTCTGAGG - Intronic
1052649531 9:31283578-31283600 CTCCAAATACAGTCACATTAAGG - Intergenic
1053906191 9:42846877-42846899 CACCAAATGCATTCTTACTATGG + Intergenic
1054352218 9:64027702-64027724 CACCAAATGCATTCTTACTATGG + Intergenic
1054367949 9:64363896-64363918 CACCAAATGCATTCTTACTATGG + Intergenic
1054528771 9:66158621-66158643 CACCAAATGCATTCTTACTATGG - Intergenic
1054675570 9:67853640-67853662 CACCAAATGCATTCTTACTATGG + Intergenic
1055361905 9:75500574-75500596 CTCCAAATGCAGTCACATTTGGG + Intergenic
1056277925 9:85011415-85011437 CTCCAAATAGAGTCATACTAAGG - Intronic
1056328733 9:85504068-85504090 CTCCAAATTCAGTCACACTCTGG + Intergenic
1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG + Intergenic
1056939403 9:90942056-90942078 CTCCAAATGCAGTCACACTGGGG + Intergenic
1057372790 9:94489218-94489240 CACCAAATGCATTCGTACTATGG + Intergenic
1060663570 9:125419136-125419158 CTCCAAAAGAAGCCAGACTCAGG - Intergenic
1203552844 Un_KI270743v1:178688-178710 CACCAAATGCATTCTTACTATGG + Intergenic
1186547005 X:10460366-10460388 CTCTGAAACCAGTCATCCTAGGG - Intronic
1187306146 X:18097020-18097042 CTCCAAATGCAGTCACATTCGGG + Intergenic
1188031559 X:25269510-25269532 TTCTATAAGCAGTCATACAAGGG + Intergenic
1188189124 X:27152507-27152529 CTCCAAATACAGTCACACTGAGG + Intergenic
1189343684 X:40223860-40223882 CTCCAAATGCAGTCACATTGGGG + Intergenic
1191182091 X:57574991-57575013 CTCCAAAATTAGTGATCCTAGGG + Intergenic
1191215467 X:57928525-57928547 CTCCAAAATTAGTGATCCTAGGG - Intergenic
1192594173 X:72388694-72388716 CTCCAAATGCAGCCACATTAGGG - Intronic
1192622266 X:72690379-72690401 CTCCAAATATAGTCATATTAGGG - Intronic
1194602992 X:95946622-95946644 CTCCAAATGCAGTCACATTAGGG - Intergenic
1197723669 X:129761562-129761584 CTCCCAAAGCAGTGGGACTATGG - Intronic
1198586793 X:138130600-138130622 CTCCAAATACAGTCACATTATGG - Intergenic
1199065835 X:143417408-143417430 CTGCAAAAGCCATCATACAAAGG - Intergenic
1202243313 Y:22791943-22791965 CTCCCAAAGGGGTCTTACTATGG - Intergenic
1202396300 Y:24425693-24425715 CTCCCAAAGGGGTCTTACTATGG - Intergenic