ID: 1180127273

View in Genome Browser
Species Human (GRCh38)
Location 21:45801042-45801064
Sequence CCATTGCCAGAGTTGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 192}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180127273 Original CRISPR CCATTGCCAGAGTTGGAGAG TGG (reversed) Intronic
900326337 1:2110358-2110380 CCAGTGCCGGAGCTGCAGAGAGG - Intronic
900561898 1:3311326-3311348 CCAAGGCCAGAGTTGGGGAGAGG + Intronic
900996557 1:6126294-6126316 CCATACCCAGAGGTGGAGGGTGG - Intronic
901120415 1:6887558-6887580 CCATTTCCAGAGGCAGAGAGAGG - Intronic
904604493 1:31691352-31691374 CCCTGGCCAGGGTGGGAGAGCGG + Intronic
904746705 1:32715907-32715929 ACAGTGGCAGAGGTGGAGAGGGG - Intergenic
905870769 1:41403297-41403319 GCAGTGACAGAGATGGAGAGAGG - Intergenic
907302505 1:53497269-53497291 CCACGGACAGAGTGGGAGAGGGG - Intergenic
909265695 1:73555712-73555734 CCATTGACACATTGGGAGAGTGG + Intergenic
911708456 1:101041705-101041727 ACATGGCCAGAGCAGGAGAGAGG + Intergenic
912562732 1:110561963-110561985 CCAGTCCCAGGCTTGGAGAGTGG + Intergenic
913267469 1:117059527-117059549 CCAAGGTCAGAGTTGGCGAGTGG - Intergenic
914521282 1:148419033-148419055 ACATGGCCAGAGCAGGAGAGAGG + Intergenic
915083616 1:153369240-153369262 CCTCTCCCAGAGTTGGTGAGAGG - Intergenic
915419859 1:155771506-155771528 CTGTTGCCCGGGTTGGAGAGCGG + Intronic
918402316 1:184175835-184175857 CCAAGGCGAGTGTTGGAGAGGGG - Intergenic
919732783 1:200924479-200924501 CCATTGCCAGGGATGGGGAATGG - Intergenic
920398375 1:205662263-205662285 CCATTGCTAGAGGTAGAAAGGGG - Intronic
920730924 1:208483607-208483629 CCAATGCCAGAGATGGGGATGGG + Intergenic
920938433 1:210457645-210457667 CGTTTGCCAGGATTGGAGAGAGG - Intronic
1065318929 10:24490992-24491014 ACATTGACAGAGTTGCAGAACGG - Intronic
1067792473 10:49298578-49298600 CCCTTCCCAGAGGTGGAGAGGGG + Intergenic
1068156604 10:53206751-53206773 CAATTCCCAGTGTTGGAGATGGG + Intergenic
1068318869 10:55383327-55383349 CCATTGACAGAGGAGCAGAGTGG - Intronic
1073062173 10:100739522-100739544 CGCTGGGCAGAGTTGGAGAGGGG - Intronic
1073127403 10:101159907-101159929 CACTTGGCAGAGATGGAGAGTGG - Intergenic
1074716923 10:116228389-116228411 CCATAGCCAGAAATAGAGAGTGG - Intronic
1074973745 10:118564724-118564746 CCATTAGGAGAGTTGGGGAGGGG - Intergenic
1076541266 10:131216627-131216649 CCAGGGACAGAATTGGAGAGGGG + Intronic
1077364262 11:2155202-2155224 CCCTTGCCAGGGATGGAGACCGG - Intronic
1077782905 11:5351489-5351511 CCATTGCCAGCTTTGCAAAGAGG - Exonic
1078134334 11:8639888-8639910 CCAGTGCCAGAGCAGAAGAGAGG - Intronic
1079063921 11:17273477-17273499 CAATTCCCAGAGTGTGAGAGGGG - Intronic
1080792057 11:35530195-35530217 CCAAGGCCAGAGATGGAGAAGGG + Intronic
1083389075 11:62334833-62334855 GGAATGCCAGAGTTGGGGAGAGG - Intergenic
1084606199 11:70173557-70173579 CCATGGCCAGAGGTGGAGCAAGG + Intronic
1084945222 11:72634620-72634642 CCCAGGCCAGAGTTGGGGAGGGG - Intronic
1089032894 11:115351789-115351811 CCAATTCCAGAGCTGCAGAGGGG - Intronic
1093919796 12:24846918-24846940 TCATTGGAAGACTTGGAGAGAGG + Intronic
1094359017 12:29609893-29609915 CTACTGCCAGAGTTGGAGGTGGG - Intronic
1098143305 12:67472677-67472699 GCACACCCAGAGTTGGAGAGAGG + Intergenic
1099365085 12:81758699-81758721 CCATTGTCAAAGGAGGAGAGGGG + Intronic
1101034515 12:100692250-100692272 GCATTGCCAGTGTTGGAGGAGGG + Intergenic
1102020049 12:109675970-109675992 CCATGGGCAGAGTTTGAGAGAGG - Intergenic
1103844540 12:123892304-123892326 CCATGGCCAGAGTGGGAGCAAGG + Intronic
1103973155 12:124685006-124685028 CCACTGCCTGAAGTGGAGAGAGG - Intergenic
1106467092 13:30023150-30023172 CCATTGCAATAGGGGGAGAGAGG - Intergenic
1107009776 13:35657212-35657234 CCATAGCTAGAGTTGAACAGTGG + Intronic
1107264573 13:38537727-38537749 TCACAGCCAGAGTTGGAGTGTGG + Intergenic
1107329171 13:39279834-39279856 CCATTCCCAAAGTTGGAGGTGGG + Intergenic
1108159038 13:47618749-47618771 CCATTGGCAGAGTGGCAGAATGG + Intergenic
1111896903 13:94153485-94153507 CCATTTTCAGAGTTGGTGAGGGG - Intronic
1112165263 13:96911510-96911532 CCAGTTCCAGAGGTGGAGAGTGG - Intergenic
1112719809 13:102230533-102230555 CCAATTCCAGTGTTGGGGAGTGG + Intronic
1114588488 14:23836857-23836879 CCATTGCCAGTTTTGGAGTCAGG + Intergenic
1116106932 14:40520655-40520677 CCATTACCACAGTGAGAGAGGGG - Intergenic
1117106604 14:52403687-52403709 CCATTGCCAGCTTTGAAGATGGG + Intergenic
1119901522 14:78264472-78264494 TCAGTGGCAGAGTTGGGGAGGGG + Intronic
1122076047 14:99235201-99235223 CCATGTTCAGAGCTGGAGAGAGG + Intronic
1122529850 14:102417986-102418008 CCATTGACTGAGATGGAGACTGG + Intronic
1122629146 14:103099402-103099424 CCATTCCCTGTGTTGGGGAGGGG + Intergenic
1122785795 14:104162785-104162807 CCATTTCCAGAGGAGGAAAGGGG + Intronic
1126201154 15:45987601-45987623 TGGTTGCCAGAGCTGGAGAGAGG - Intergenic
1127465688 15:59242277-59242299 CCAATGCCAGGGCTGGAGTGGGG + Intronic
1128768668 15:70266233-70266255 ACACTGGCAGAGATGGAGAGGGG - Intergenic
1128799694 15:70489649-70489671 CCGGTGCCAGAGTAGGAAAGGGG + Intergenic
1132018805 15:98342344-98342366 CCATTGCAAGGGGTGGAGAATGG - Intergenic
1132944808 16:2527040-2527062 CCCATGCCTGTGTTGGAGAGAGG + Intronic
1135579744 16:23615339-23615361 CCATTGCCCAAGCTGGAGTGTGG + Intronic
1137666067 16:50249786-50249808 CCATTGCCAGGTGTGGGGAGCGG + Intronic
1138771908 16:59675773-59675795 TGATTGCCAGAGCTGGAGACGGG - Intergenic
1139502839 16:67381989-67382011 CCATTGCCTTACTTGGAGATAGG - Intronic
1140336360 16:74108626-74108648 ACATTTCCAGATTTGGAGTGTGG + Intergenic
1141418612 16:83897141-83897163 ACATAGCCAGAGCAGGAGAGAGG + Intergenic
1142646245 17:1315649-1315671 CCATTGCCCCAGTTGGAGGCAGG + Intergenic
1144102608 17:11955752-11955774 CCATTTCCAGTGCTGGAGAGAGG - Intronic
1144774010 17:17775238-17775260 CTATTGCCTGAGTTGGAGTGCGG + Intronic
1147715668 17:42506368-42506390 CCACTGCTAGAGTAGGAGGGAGG + Intronic
1148142188 17:45336826-45336848 CCCTTTCCTGAGATGGAGAGCGG - Intergenic
1148708837 17:49661436-49661458 CCATTGGCAGAGATGGGGAAGGG - Intronic
1149038991 17:52165057-52165079 GGTTTGCCAGACTTGGAGAGAGG + Intergenic
1151533952 17:74726739-74726761 TCACTGCCAGAGTTGAACAGTGG + Intronic
1152522045 17:80862418-80862440 CCATGGCCAGACGTGGGGAGGGG - Intronic
1152847124 17:82608062-82608084 CCATTGCCCAAGCTGGAGTGTGG - Intronic
1153497513 18:5714931-5714953 ACAATACCAAAGTTGGAGAGAGG - Intergenic
1156401069 18:36741247-36741269 CTATTGCAAGAGTTTGGGAGGGG + Intronic
1163115726 19:15187746-15187768 CCAGTGACAGAGTTGGGGGGTGG - Intronic
1164305417 19:24001469-24001491 CCATTGCCAGCAGTTGAGAGTGG - Intergenic
1165331405 19:35142840-35142862 CAAGTGCCAGAGTTGAAGGGCGG + Intronic
1165437260 19:35802878-35802900 CAAATGCCAGAGATGGACAGAGG - Intronic
1166017788 19:39996142-39996164 CCATTGCCAGAATATAAGAGTGG + Intronic
1166107175 19:40603059-40603081 CTGTTGCCATGGTTGGAGAGCGG - Intronic
1166801507 19:45460611-45460633 AGATTGGCAGAGTTGGAGGGAGG + Intronic
1167271890 19:48510711-48510733 CCCTTGGCAGAGGTGCAGAGTGG + Intronic
925327725 2:3036300-3036322 CCCTTTCCAGATTTGGGGAGGGG - Intergenic
926660967 2:15465463-15465485 CCATTGCTAGAGGTAGAGAAAGG - Intronic
932428599 2:71659709-71659731 TCATTGCCTGAGATGGAGAGGGG + Intronic
934546801 2:95224515-95224537 ACATGGCCAGAGCAGGAGAGGGG + Intronic
934666071 2:96171699-96171721 CAATTGCCAGAGAGGGTGAGTGG + Intergenic
936647525 2:114388913-114388935 CCACTGGCAGAGTAGCAGAGCGG + Intergenic
937028538 2:118719088-118719110 TCATTACCAGGGCTGGAGAGAGG + Intergenic
939991849 2:148883042-148883064 AAATTGCCAGAGCTGGACAGAGG - Intronic
940000815 2:148964862-148964884 CCATTGGCTGTATTGGAGAGTGG + Intronic
940262580 2:151797432-151797454 CAATTGGCAGGGATGGAGAGGGG + Intronic
940606500 2:155930359-155930381 CCATTAGCAGAGCTGGAGACAGG + Intergenic
940894027 2:159063241-159063263 CCATTTCCAGAATTGGATATAGG + Intronic
941645788 2:168039638-168039660 CCTTTGCCAGAGGTGGAGGGAGG + Intronic
945077702 2:206056750-206056772 CCCTTGCCCCAGGTGGAGAGAGG + Exonic
947392257 2:229651418-229651440 CCATGGCCAGAGCTTGGGAGAGG - Intronic
948091365 2:235298863-235298885 CCAGTGACTGGGTTGGAGAGTGG + Intergenic
948298988 2:236887997-236888019 TCCTTTCCAGAGTGGGAGAGAGG - Intergenic
1168966105 20:1898951-1898973 CCTTTGCGACAGATGGAGAGGGG + Intronic
1169785288 20:9353641-9353663 CCAGTGGCAGAGGTGGAGAGTGG - Intronic
1173546593 20:43902734-43902756 CCATTTCCAGGGGTGGACAGTGG - Intergenic
1174378204 20:50140059-50140081 TCATTCACAGAGATGGAGAGAGG - Intronic
1175532942 20:59686367-59686389 CCTTTTCTAGAGTTGGAGGGAGG + Intronic
1175550940 20:59817242-59817264 CCATTGCCAATTTTGGAGACTGG + Intronic
1175742143 20:61427194-61427216 ACATTCCCAGCGTTGCAGAGAGG + Intronic
1176177259 20:63734625-63734647 CCACTGCAAGAGATGGACAGAGG - Exonic
1178155093 21:29843748-29843770 CATTTGTCAGAGTTGGGGAGGGG + Intronic
1179225830 21:39452078-39452100 CCATTTCGACAGTTGGAAAGAGG - Exonic
1179538538 21:42068298-42068320 CCAGTGCCTGAGTGAGAGAGGGG + Intronic
1180127273 21:45801042-45801064 CCATTGCCAGAGTTGGAGAGTGG - Intronic
1181842050 22:25671589-25671611 ACAGTGACAGAGTGGGAGAGTGG - Intronic
1183420830 22:37710405-37710427 CCTGGGCCAGGGTTGGAGAGAGG - Exonic
1184053669 22:42029059-42029081 GCCTTGCCAGAGTGGGAGAATGG - Intronic
1184422913 22:44392181-44392203 CCATTGACAGAGTTGAAGGTTGG + Intergenic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950581672 3:13866352-13866374 CCATTCCCACAGGTGGCGAGAGG - Intronic
952412265 3:33060078-33060100 CCACGTGCAGAGTTGGAGAGTGG + Intronic
952606224 3:35149986-35150008 CCATTGCCCGAGTTGTGGAGTGG - Intergenic
954361199 3:50123785-50123807 TCACTGGCAGAGCTGGAGAGGGG + Intergenic
956830679 3:73044547-73044569 CCGTTGCCAGGGCTGGAGAGTGG - Intronic
956917840 3:73891913-73891935 CAACTCTCAGAGTTGGAGAGTGG + Intergenic
958631315 3:96686641-96686663 CCACTGCCAGGGGTGGAGAAGGG + Intergenic
960483139 3:118217738-118217760 CAGTTGCCTGAGGTGGAGAGTGG - Intergenic
961150422 3:124632918-124632940 CATTTGCCAGATTTGGAGATAGG + Intronic
961205248 3:125076440-125076462 CCATTGTCAGAGTGGGCTAGGGG + Intergenic
961844842 3:129753073-129753095 ACATTCCCAGAGTTGGAGGAAGG - Intronic
962186168 3:133261941-133261963 CCAATGCCAGAATTTGAGACAGG - Intronic
963064348 3:141251824-141251846 CTATTTCTAGAGTTGGGGAGAGG + Intronic
964670721 3:159222523-159222545 TGATTACCAGAGGTGGAGAGAGG + Intronic
964799103 3:160533910-160533932 CCATTGTCAGAGTTGAATATTGG - Intronic
965683757 3:171279539-171279561 CAATAGCCAGAGTTGGCAAGGGG - Intronic
966781058 3:183584502-183584524 CTATTGCCAGAGATGGCCAGAGG - Intergenic
967108271 3:186271209-186271231 CTATTTCCAGACTTGGAGAATGG + Intronic
967636289 3:191805909-191805931 TCATTGCCAGTGTTGGAGGATGG - Intergenic
967994113 3:195153947-195153969 CCAATGCCAGAGCCGGGGAGCGG + Intronic
970238705 4:13985433-13985455 GAATTGCATGAGTTGGAGAGAGG + Intergenic
974771305 4:66417728-66417750 CCATTGTCAGAGTGGAAGAAAGG - Intergenic
975057032 4:69946903-69946925 ACATTGTCAGAGCTGCAGAGAGG + Intergenic
980282097 4:130735954-130735976 GCATCGCTGGAGTTGGAGAGAGG + Intergenic
981391426 4:144196001-144196023 CACTTGCCAGAGCAGGAGAGAGG - Intergenic
981731411 4:147903043-147903065 CAATTCCCAAAGTTGGAGAAGGG - Intronic
982624811 4:157753244-157753266 CCATTGCCACATTTACAGAGAGG - Intergenic
983297116 4:165879968-165879990 CCATATCCAGGGTTGGGGAGAGG - Intronic
983810924 4:172061299-172061321 CCCTTGCCAGAGAAGGAGACTGG - Intronic
984047069 4:174814470-174814492 CCACTGGCAGAGTGGCAGAGTGG - Intronic
985929896 5:3048999-3049021 TTATTGCCAGATTTGGAGAAAGG - Intergenic
986650571 5:9959492-9959514 CTATTGCCAAAGATGGAGGGAGG + Intergenic
986735338 5:10663682-10663704 TCATTGCCAGAGACGCAGAGGGG - Intergenic
987759939 5:22148734-22148756 TCAATGACAGAGTTGGAGATTGG - Intronic
991052022 5:62283252-62283274 CCATTGCCCAATCTGGAGAGTGG + Intergenic
991444801 5:66688099-66688121 TCATGACCAGAGATGGAGAGTGG - Intronic
991452972 5:66772247-66772269 CCATTTACAGAGTTGGACATAGG + Intronic
991894667 5:71382165-71382187 TCAATGACAGAGTTGGAGATTGG - Intergenic
992479028 5:77131835-77131857 CCCTTTCCAGAGTTAGAAAGGGG + Intergenic
992947009 5:81820992-81821014 TCATCTCCAGTGTTGGAGAGTGG + Intergenic
994144581 5:96379899-96379921 CCAGTGCCAGGATTGGATAGAGG + Intergenic
998302791 5:141041135-141041157 ACAATGCCAGAGGTGGAGGGGGG - Intergenic
999870764 5:155748064-155748086 CCCTGGTCAGAGTTGGAGTGTGG - Intergenic
1001485624 5:172117618-172117640 CCATTTCCAGAGCTGGACAGAGG - Exonic
1001538134 5:172514125-172514147 CCACAGCCAGAGTTGGGCAGGGG - Intergenic
1005403250 6:25457429-25457451 TCCTTCCCAGAGTTGGTGAGTGG + Intronic
1008691837 6:53987763-53987785 CCATTAACTGAGATGGAGAGAGG + Intronic
1010846830 6:80720032-80720054 TCATTGCCAAAGTTTCAGAGTGG - Intergenic
1013616136 6:111845133-111845155 TCACTGCCTGAGTTGGACAGGGG + Intronic
1014984396 6:127984781-127984803 CTGTTCCCAGAGTTGGAGACAGG + Intronic
1018168083 6:161118672-161118694 CAATTGCAAGTATTGGAGAGGGG - Intergenic
1019973145 7:4558281-4558303 GCATTGCCAGCGGTGGAAAGAGG + Intergenic
1020996242 7:15269085-15269107 ACATTGGCAGAGTTGAATAGTGG - Intronic
1023740516 7:43277188-43277210 CCATTGCCTGAGTAGGAGGATGG - Intronic
1027395118 7:77746326-77746348 ACATGGCCAGAGCAGGAGAGAGG + Intronic
1027966438 7:85015971-85015993 CCATTTCAAGAGTTAGAGGGGGG + Intronic
1033241544 7:139683666-139683688 CCATTGCCAGGGTATGACAGTGG - Intronic
1034953301 7:155316112-155316134 CCGTTGCCACAGATGGGGAGAGG + Intergenic
1035330964 7:158097207-158097229 CCACTGGCAGGGTGGGAGAGGGG + Intronic
1036149299 8:6283238-6283260 GCAGTGACAGAGGTGGAGAGGGG + Intergenic
1037875524 8:22545370-22545392 CCATTGACAGAGTGTGAAAGAGG + Intronic
1038387415 8:27161987-27162009 CCATGGCCAGGGCTGAAGAGAGG + Intergenic
1040623461 8:49116589-49116611 ACATTGCCAGACTTGGGGAGGGG - Intergenic
1040979788 8:53234512-53234534 ACATTGCCAGAATGGGAGACAGG + Intronic
1047324953 8:123827015-123827037 CCATTGCCAAAGTGGGTCAGTGG + Intergenic
1050133918 9:2441742-2441764 CCATGGCCATTGTTGGAGAAGGG + Intergenic
1051121067 9:13753037-13753059 CGTGTCCCAGAGTTGGAGAGGGG - Intergenic
1052259389 9:26494098-26494120 CCTTTGCAAGGGTGGGAGAGGGG + Intergenic
1056478860 9:86980637-86980659 CCATTGCAAGGTGTGGAGAGAGG - Intergenic
1058597378 9:106629661-106629683 CCATCGCCAGAGGTATAGAGAGG - Intergenic
1060202798 9:121661495-121661517 GCATTGCCAAAGTGGGGGAGGGG - Intronic
1060295959 9:122343072-122343094 CCACGGCCGGAGTTGGGGAGTGG + Intergenic
1061759866 9:132843162-132843184 CCATTGCTAGAGGTGGAGCCTGG + Intronic
1062712615 9:137984912-137984934 TCACTGCCAGAGTTGTAGTGGGG + Intronic
1186154390 X:6710415-6710437 CCATTCCCAGAGTTAAATAGAGG + Intergenic
1195303966 X:103560768-103560790 TCATTGCCAGGGTTGGGGTGTGG + Intergenic
1196220384 X:113107235-113107257 CCATTGTCAGAGTTGGCAAGTGG - Intergenic
1196701028 X:118669057-118669079 CCATTGCCAGATTTTAAGAAAGG + Intronic
1196889362 X:120277106-120277128 CCAATCCCAGAGTTGGGGAGGGG - Intronic
1197970644 X:132111515-132111537 CCAGTGCCAGAGTGGGTGATTGG - Intronic
1198768475 X:140102913-140102935 CCATTGTCAGCTTTGGAGGGGGG + Intergenic