ID: 1180128186

View in Genome Browser
Species Human (GRCh38)
Location 21:45805989-45806011
Sequence GCTGTGTCTCAGCATTAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180128181_1180128186 14 Left 1180128181 21:45805952-45805974 CCCATTGCATGAGAAGATGGAGG 0: 1
1: 0
2: 0
3: 17
4: 234
Right 1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 141
1180128183_1180128186 13 Left 1180128183 21:45805953-45805975 CCATTGCATGAGAAGATGGAGGA 0: 1
1: 0
2: 0
3: 17
4: 209
Right 1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180128186 Original CRISPR GCTGTGTCTCAGCATTAGAG AGG Intronic
900857541 1:5198040-5198062 ATTGTGTCCCAGCATTAGAGTGG - Intergenic
905626714 1:39494162-39494184 GCTGTGGCCCAGCCTTAGTGTGG + Intronic
905994353 1:42368154-42368176 GGAGAGTCTCAGCATTAGAAAGG + Intergenic
914503803 1:148270926-148270948 GCTTTTTCTCGTCATTAGAGTGG + Intergenic
917210840 1:172630578-172630600 TCTGTGTCTCAGCGTGGGAGGGG + Intergenic
924553501 1:245099459-245099481 GCTGCGTCCCAGCATCAGAAGGG - Intronic
1068745094 10:60521143-60521165 ACTGTGTATCAGCTTTAAAGAGG + Intronic
1071215126 10:83392716-83392738 TCTATATATCAGCATTAGAGAGG + Intergenic
1072743665 10:97925373-97925395 AGTGTGTGTCAGCATGAGAGTGG + Intronic
1073453127 10:103621275-103621297 GCTGCGTCCCAGCTTTAGGGTGG + Intronic
1074402102 10:113150444-113150466 GCTGTGTCCCATCATTTGACAGG - Intronic
1076473925 10:130739315-130739337 GCTGTGCCTCAGCCTGAGTGGGG + Intergenic
1077489539 11:2854234-2854256 GCTGTGTGTCAGCATTGGCCAGG - Intergenic
1078609832 11:12810517-12810539 GATGTGTCTCAGCAAGAGAGGGG - Intronic
1083149422 11:60782637-60782659 CACGTGTCTCAGCATTACAGTGG + Intergenic
1084128979 11:67119097-67119119 GCGGTGTGTCCGCGTTAGAGGGG + Intergenic
1086883470 11:92176277-92176299 GCTGTGGCACTGCATTAGAGTGG - Intergenic
1087129180 11:94653933-94653955 TCTTTGCCTGAGCATTAGAGCGG + Intergenic
1087660549 11:100982560-100982582 GCTGTGTCTTACCATTATAAAGG + Intronic
1090440188 11:126718884-126718906 GCTGGGATTCAGCATCAGAGAGG - Intronic
1093051319 12:14508073-14508095 GCTCTGTCTCAGAATTAGCAAGG - Intronic
1096026392 12:48367115-48367137 GCTGTATATCAGAATTAGTGAGG - Intergenic
1100969897 12:100057230-100057252 GCTGGATCTCAGCCATAGAGAGG + Intronic
1101236507 12:102795172-102795194 TCTGTGTCTCCCCATGAGAGAGG + Intergenic
1102481789 12:113228832-113228854 GCTCAGTTTCAGCTTTAGAGAGG + Intronic
1108522655 13:51259640-51259662 TCTGTGTCTGAGAATGAGAGAGG - Intronic
1111455691 13:88480997-88481019 CCTGAGACTCAGCATTGGAGAGG - Intergenic
1112807788 13:103181977-103181999 GCTGTGTGTAAGTAGTAGAGGGG - Intergenic
1113786502 13:113004610-113004632 GCCTTGTCTCAGCTTTACAGAGG + Intronic
1116133109 14:40885154-40885176 GCTGTGTCTTAGCTTGAGAGAGG + Intergenic
1116197295 14:41744559-41744581 TCTGTGTCTCTGAATTGGAGTGG - Intronic
1116630224 14:47321142-47321164 GCTCTGTCTTAGCTTGAGAGTGG + Intronic
1117979490 14:61328481-61328503 GTTGTGCCTCAGCCTTGGAGAGG + Intronic
1118837925 14:69489696-69489718 GCAGTGTCTCATCTATAGAGTGG + Intronic
1119727848 14:76932969-76932991 GCTGGGTGTCAGCAGGAGAGTGG + Intergenic
1121089534 14:91171505-91171527 GATGTGTCTCAGCCTTGGGGAGG + Intronic
1122929689 14:104927582-104927604 TCTCTGTCTCAGCACTGGAGGGG + Intronic
1125214999 15:37262020-37262042 GCTGGGTCTCACAATTAGGGAGG + Intergenic
1125473920 15:40031410-40031432 GCTGTTTCTCAGGATTTGGGTGG + Intronic
1127053485 15:55108911-55108933 ATTGTGTCTCAGAATTAGTGAGG + Intergenic
1129443683 15:75601025-75601047 GCTGTGTCAAAGCATCAGAATGG - Intronic
1138187070 16:54985039-54985061 CCTGTGTCACAGCAGTGGAGAGG - Intergenic
1138241846 16:55433844-55433866 GCTGTGTGTCAGCATGGGGGAGG - Intronic
1140549110 16:75844768-75844790 GTTGTGTCTCAGGAGTAGGGAGG + Intergenic
1143651217 17:8265256-8265278 GCAGAGGCACAGCATTAGAGGGG - Intronic
1146644556 17:34568410-34568432 GCTGTGTCTCCTCATCAGAGAGG - Intergenic
1146701338 17:34962736-34962758 GCTGTCTCTCAGTAGTATAGCGG + Exonic
1147371253 17:39994616-39994638 GCTGTGGCTCAGCAACAGCGAGG - Intronic
1152281476 17:79387178-79387200 GCTGTGTGTAAGCATGAGTGTGG - Intronic
1154933363 18:21024821-21024843 GCTGTGTAGCAGCTTTATAGAGG + Intronic
1155063491 18:22248806-22248828 GCTGTGTCTGATCTTTTGAGGGG + Intergenic
1157387097 18:47266501-47266523 GCTGAGTCCCAGCAGTAGGGTGG - Intergenic
1158236818 18:55324762-55324784 GCTTTGTCTAAGCACCAGAGAGG - Intronic
1160247834 18:77173853-77173875 GCCTTGGCTCAGCATTACAGAGG + Intergenic
1162067780 19:8136620-8136642 GCAGGGTCCCAGCCTTAGAGGGG - Intronic
1162308992 19:9893718-9893740 GCTGTGTCTCAGGATTAATGAGG + Intronic
1163359053 19:16834022-16834044 GCTGAATCTCAGCTTTAAAGGGG + Intronic
1167225233 19:48234345-48234367 GCTGTGTCTCAATATCACAGAGG - Intronic
927030865 2:19119344-19119366 GCTGGGTCCCAGTTTTAGAGAGG - Intergenic
928056328 2:28058992-28059014 GCTGTATCTCAGGATAAGGGAGG - Intronic
929010406 2:37437059-37437081 ACTGTTTCTCAGGATTTGAGAGG + Intergenic
931271339 2:60706090-60706112 GCTGTGTGTCAGCACCCGAGTGG - Intergenic
931680394 2:64742253-64742275 GCAGTGGCTCAGCAAGAGAGGGG - Intronic
933023829 2:77228472-77228494 GCTGAATCTCAGCTTTGGAGAGG - Intronic
936645182 2:114360618-114360640 GCTGGGTCTTAGCATTAGACTGG + Intergenic
938063425 2:128268900-128268922 GCTGTGACGCAGCATGAGGGGGG + Intronic
939539424 2:143475257-143475279 GCTGTCTGTCAGCATTTGTGAGG + Intronic
941536621 2:166730195-166730217 ACTGTGTCTCTTCAGTAGAGAGG - Intergenic
941767571 2:169315137-169315159 GATGAATCTCAGCATTAGATAGG - Intronic
944404821 2:199372000-199372022 GCTGTGTCTCGGTATCTGAGTGG - Intronic
1169246727 20:4031884-4031906 GCTTTGGCTCGGCATCAGAGGGG - Intergenic
1170067955 20:12334947-12334969 GCTGTGTCTCAGACTTTTAGAGG + Intergenic
1171242719 20:23585044-23585066 GCTGTGTCTCATCGTGGGAGAGG + Intergenic
1173001695 20:39109890-39109912 GCTGTGTGTCAGCACAGGAGTGG + Intergenic
1173302439 20:41816195-41816217 GCTTTGTATCTGCATTGGAGTGG + Intergenic
1175329881 20:58156246-58156268 GGTGTGTCACAGGATAAGAGAGG + Intronic
1178340458 21:31781819-31781841 GATGTGCCTCAGAATGAGAGTGG - Intergenic
1180128186 21:45805989-45806011 GCTGTGTCTCAGCATTAGAGAGG + Intronic
1181169132 22:20998432-20998454 GCTGGCTCCCAGCACTAGAGTGG - Exonic
1182973480 22:34599773-34599795 GCTGTGTCTGAGGAGTGGAGAGG - Intergenic
1183829478 22:40410203-40410225 GTTGTGTCCCAGCATCTGAGGGG - Exonic
1184427238 22:44418235-44418257 GGTTTTTCTCAGGATTAGAGTGG + Intergenic
1184732670 22:46379301-46379323 GGTGTGTCTCAGCTTCAGACAGG + Intronic
1184908406 22:47508639-47508661 CCTGTGTCCCAGCCTTAGGGTGG + Intergenic
951274289 3:20666273-20666295 TCTGTGTCTAAGTATTTGAGAGG + Intergenic
955030016 3:55206976-55206998 TCTGGGGCTCACCATTAGAGTGG - Intergenic
957138421 3:76319929-76319951 TCTGTATCCCAGGATTAGAGGGG + Intronic
960212354 3:114985352-114985374 TCTGTCTCTCAGCATTAATGGGG + Intronic
961142565 3:124567484-124567506 GCTGTGTGTCAGAATTGGGGTGG + Intronic
963990881 3:151652487-151652509 GCTGTGTCTCAAATTTTGAGAGG + Intergenic
966600776 3:181773146-181773168 GCTGTGTTTCAGTATTAAAAAGG + Intergenic
967430267 3:189375898-189375920 GCTGTGTCTGAGAATTAAATTGG + Intergenic
969228852 4:5816039-5816061 GCTGTGTGTCAGCATTACCCAGG + Intronic
970448359 4:16142621-16142643 GATGTGTCTCAGTTTTATAGAGG + Intergenic
971487222 4:27172414-27172436 GCTGTGTTTAAGCATTAACGGGG - Intergenic
973211200 4:47617591-47617613 GCTGTTTCTCAGCATCACTGGGG - Intronic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
975272853 4:72457919-72457941 GCTGTGACTCATCTTTGGAGGGG + Intronic
975804628 4:78099121-78099143 CCTAGGTCTCAGCTTTAGAGAGG + Intronic
976053036 4:81031006-81031028 GCTCTTTCTCAGCGTTGGAGTGG + Exonic
977766859 4:100808902-100808924 GCTATGGCTCAGCTTTAGAAAGG + Intronic
984849637 4:184142751-184142773 GCTGAGTCTCAGCTTCAGGGAGG + Intronic
984858435 4:184215878-184215900 GGTGTGTCTCAGCATGACGGAGG + Intronic
986503503 5:8426156-8426178 GCTGTCTCTCTGCAGGAGAGAGG - Intergenic
995215618 5:109591386-109591408 ACTGTATTCCAGCATTAGAGAGG - Intergenic
995683015 5:114741768-114741790 GGTGTGTCTCAGAATGAGATTGG - Intergenic
996381714 5:122868419-122868441 GCTGTTTCTCAAAAGTAGAGTGG + Intronic
996499144 5:124197579-124197601 GCTGTGTGTCTGCCTTAGGGGGG - Intergenic
998387320 5:141765000-141765022 GCTATTTCTCAGCTTAAGAGAGG + Intergenic
998489027 5:142529758-142529780 GAGGTGTCTCATCATTAGGGAGG + Intergenic
1001673360 5:173492478-173492500 GCTCTGTCTCATCATAAGGGAGG - Intergenic
1003407699 6:5837375-5837397 CCTGTGTCCCAGCCCTAGAGGGG - Intergenic
1005296114 6:24428979-24429001 GATGTGATTCAGCATGAGAGAGG + Exonic
1007548293 6:42710186-42710208 GCTGTGTCTCCCCATCAGACTGG + Intronic
1008150202 6:47940917-47940939 GCTGTGGATCAGCATTGGAATGG - Intronic
1014416985 6:121195382-121195404 GCTGTCTCTCAGAAGTAGAGTGG - Intronic
1015123500 6:129726856-129726878 ACTCTGTCTCACCATAAGAGGGG + Intergenic
1016641867 6:146358959-146358981 ACTGTGTCACAGCATGAGAATGG - Intronic
1017653011 6:156600296-156600318 TCTGTGTCTCAGCCTGTGAGGGG - Intergenic
1017873178 6:158503115-158503137 GCCCTGACTCAGCATCAGAGAGG - Exonic
1018594748 6:165466723-165466745 GTTTTGTCTCAGGATTAGGGAGG - Intronic
1020006330 7:4785366-4785388 GCTCTGTCTCAGCCTTAGAGTGG - Intronic
1022999537 7:35793983-35794005 GTTGTCTCTCAGTATCAGAGGGG + Intergenic
1029960261 7:104682721-104682743 ACAGTGTCTCAGCAGTTGAGAGG - Intronic
1031893640 7:127323717-127323739 GCTCCGTCTCAGCTGTAGAGGGG + Intergenic
1033139821 7:138816191-138816213 GTTGTGTCTCAGGAATAGGGAGG - Intronic
1034409180 7:150930042-150930064 GATATGGCTCAACATTAGAGGGG - Intergenic
1036632273 8:10524142-10524164 GCTGTGGCTCAGCCTCGGAGGGG + Intergenic
1038083792 8:24171724-24171746 GGTGTGTCTCAGCCACAGAGAGG + Intergenic
1038404486 8:27311341-27311363 GCTGTCTCTCAGCGTTCCAGGGG - Intergenic
1041866397 8:62579534-62579556 TGTAGGTCTCAGCATTAGAGAGG + Exonic
1043114372 8:76231648-76231670 GCTGTGTATGATCATTACAGAGG + Intergenic
1046260797 8:111765341-111765363 GATGTGTCTCATGATTAGACTGG - Intergenic
1047719858 8:127629819-127629841 GCTGGATCTCAGCATAAGACAGG - Intergenic
1047854103 8:128891168-128891190 GCTGTGTCCCAGAATGAGAAAGG - Intergenic
1048291429 8:133184602-133184624 GCTGTGGCTCAGGATCTGAGTGG + Intergenic
1048354502 8:133642137-133642159 ACTGTGTCTCAGTATACGAGCGG + Intergenic
1049003431 8:139840258-139840280 GCTGTTCCTCAGCATCTGAGAGG - Intronic
1051032154 9:12694160-12694182 GCTGTGGCTCATCATCAGGGAGG + Exonic
1052343349 9:27384331-27384353 TCTGTTTCTCAGCTTTAGACAGG - Intronic
1057799166 9:98179483-98179505 GTGGGGTCTCAGCTTTAGAGAGG - Intronic
1057872887 9:98731577-98731599 CCTGTGTCTCAGCCTTGGAGAGG + Intronic
1062029420 9:134355549-134355571 GCAGTGGCTCAGAATTACAGTGG + Intronic
1188324810 X:28788283-28788305 TCTGTGTCTCAGCTTTATTGAGG - Intronic
1192522090 X:71811446-71811468 GCTGTGTTCCAGCATCTGAGTGG - Intergenic
1192524122 X:71827015-71827037 GCTGTGTTCCAGCATCTGAGTGG + Intergenic
1195248080 X:103014973-103014995 GCTGTGTCTCAGCATTTAAAGGG + Intergenic
1195298425 X:103502901-103502923 TCTGTGTCTCAGCATTTAAAGGG - Intronic
1195301694 X:103536137-103536159 TCTGTGTCTCAGCATTTAAAGGG - Intergenic
1195301965 X:103538759-103538781 TCTGTGTCTCAGCATTTAAAGGG - Intergenic
1196022661 X:111006718-111006740 GATGTGTATGAGCATTAAAGTGG - Intronic
1196380910 X:115088301-115088323 GCTGTGTCACAGAATAACAGGGG + Intergenic
1198688350 X:139251730-139251752 GCTGTGTCACATGATGAGAGAGG + Intergenic