ID: 1180133493

View in Genome Browser
Species Human (GRCh38)
Location 21:45844259-45844281
Sequence TGTGCAAGACCTCCCTAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180133493_1180133499 12 Left 1180133493 21:45844259-45844281 CCACTTTAGGGAGGTCTTGCACA 0: 1
1: 0
2: 3
3: 17
4: 113
Right 1180133499 21:45844294-45844316 GCATAGACACGTTGGGTGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 115
1180133493_1180133495 4 Left 1180133493 21:45844259-45844281 CCACTTTAGGGAGGTCTTGCACA 0: 1
1: 0
2: 3
3: 17
4: 113
Right 1180133495 21:45844286-45844308 TGCATGGAGCATAGACACGTTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1180133493_1180133497 8 Left 1180133493 21:45844259-45844281 CCACTTTAGGGAGGTCTTGCACA 0: 1
1: 0
2: 3
3: 17
4: 113
Right 1180133497 21:45844290-45844312 TGGAGCATAGACACGTTGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 88
1180133493_1180133496 5 Left 1180133493 21:45844259-45844281 CCACTTTAGGGAGGTCTTGCACA 0: 1
1: 0
2: 3
3: 17
4: 113
Right 1180133496 21:45844287-45844309 GCATGGAGCATAGACACGTTGGG 0: 1
1: 0
2: 0
3: 4
4: 68
1180133493_1180133500 29 Left 1180133493 21:45844259-45844281 CCACTTTAGGGAGGTCTTGCACA 0: 1
1: 0
2: 3
3: 17
4: 113
Right 1180133500 21:45844311-45844333 GGGAGGTGCCCCAGCACCTAAGG 0: 1
1: 1
2: 0
3: 16
4: 158
1180133493_1180133498 9 Left 1180133493 21:45844259-45844281 CCACTTTAGGGAGGTCTTGCACA 0: 1
1: 0
2: 3
3: 17
4: 113
Right 1180133498 21:45844291-45844313 GGAGCATAGACACGTTGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180133493 Original CRISPR TGTGCAAGACCTCCCTAAAG TGG (reversed) Intronic
904617193 1:31756275-31756297 TGAGCAAGACCTCGACAAAGCGG + Exonic
908702839 1:66920619-66920641 TGTGCTCCACCTCCCTCAAGGGG + Intronic
909725961 1:78835344-78835366 TTTGTAAGACATTCCTAAAGAGG - Intergenic
910989683 1:93042204-93042226 TGTGGAAGCCCTCCCAACAGCGG + Intergenic
912354460 1:109043186-109043208 TGAGCTGGACCTCCCAAAAGGGG + Intergenic
921462513 1:215445301-215445323 TGGGCAAGACCACCCTACAGAGG + Intergenic
922714515 1:227859943-227859965 TCTGCAGGACCTCCCCCAAGGGG - Intergenic
924629624 1:245724397-245724419 TGGGTAAGACCTCCCAATAGGGG + Intergenic
1062761854 10:28458-28480 TGGACAAGACCTCCCAACAGGGG + Intergenic
1065120920 10:22529915-22529937 TGGGAAAGACCTCCCAACAGGGG - Intergenic
1066123815 10:32319131-32319153 TGTGGAAGACTTTCCAAAAGCGG - Intronic
1068842336 10:61629744-61629766 TGCGCATGACCTGTCTAAAGGGG - Intergenic
1071302647 10:84267984-84268006 TGGGAAAGACCTCTCTGAAGAGG + Intergenic
1072899462 10:99394419-99394441 TGTGCACCACCTGCCTGAAGAGG + Intergenic
1073067713 10:100773424-100773446 TGTGCAAAAACTCCCTGAGGTGG - Intronic
1074015614 10:109530742-109530764 TGGGAGAGACCTCCCGAAAGGGG + Intergenic
1075117186 10:119636839-119636861 TGTTCAAGAAATCCCTGAAGAGG + Intergenic
1080292584 11:30687897-30687919 TGGGCAAGTCCTCCCTGCAGGGG + Intergenic
1080743330 11:35085261-35085283 TGTGCAAGACCTGCTTAGATTGG - Intergenic
1090439451 11:126713763-126713785 TGGGCGAGACCTCCTTGAAGAGG + Intronic
1092273262 12:7039704-7039726 TCTGCAAAACCCCCCTTAAGAGG - Intronic
1092929770 12:13304966-13304988 AGAGAAAGACCTCACTAAAGGGG - Intergenic
1093096796 12:14981165-14981187 TGTGGATCACCTCCCCAAAGAGG + Intronic
1103376127 12:120457423-120457445 AGCTCAAGATCTCCCTAAAGGGG + Intronic
1104193950 12:126512769-126512791 TGTGCAAGAACTCCTTAAACAGG + Intergenic
1105829645 13:24152511-24152533 TGTGCAAGACCTCACTGGGGAGG - Intronic
1115339156 14:32273396-32273418 TGGGCGAGACCTCCCAACAGGGG + Intergenic
1202836134 14_GL000009v2_random:78679-78701 TGTACAGGACCTCCCAAATGGGG + Intergenic
1126973143 15:54141520-54141542 TGTTCAAAACCTCCTTAAAATGG - Intronic
1132574775 16:659349-659371 TGTGCCAGGCCTCCCGAAGGTGG + Exonic
1146379860 17:32320632-32320654 CACGCAAGACCTCTCTAAAGAGG - Intronic
1149511654 17:57247131-57247153 TGTCCAAGACCTTCTAAAAGTGG + Intergenic
1152954762 18:28788-28810 TGGGCAAGACCTCCCAACAGGGG + Intergenic
1166140904 19:40804644-40804666 TGGGCAAGACCTCCCCAATTAGG - Intronic
1166512880 19:43421799-43421821 TTTGCTAAATCTCCCTAAAGAGG + Intergenic
1166911754 19:46163985-46164007 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1202636503 1_KI270706v1_random:48683-48705 TGTACAGGACCTCCCAAATGGGG - Intergenic
929946446 2:46375950-46375972 CCTGCAAGACCTCCCTGAGGTGG - Intronic
930925817 2:56816839-56816861 TGGGAAAGACCTCCCAATAGGGG + Intergenic
933229175 2:79786022-79786044 TATGCAAGACCACCCTTAACAGG - Intronic
933430130 2:82165836-82165858 TTTTCAAAACCTCCCAAAAGGGG - Intergenic
933465210 2:82642376-82642398 TGTGTGAGGCCTCCCAAAAGGGG + Intergenic
933482633 2:82876295-82876317 TGGGTGAGACCTCCCAAAAGGGG + Intergenic
936171588 2:110181333-110181355 TGGGTGAGACCTCCCAAAAGGGG + Intronic
936747825 2:115601176-115601198 TGTCAAAGACCACCTTAAAGTGG + Intronic
938568033 2:132538487-132538509 TGGGAAAGACCTCCCAAAAGGGG - Intronic
939538986 2:143469650-143469672 TGTGTAAGTCATACCTAAAGTGG - Intronic
941733934 2:168951447-168951469 GGTGAAAGATCTCCCTAAGGAGG - Intronic
943563760 2:189493730-189493752 TGCCCAAGACCTCCATAAACAGG - Intergenic
943987307 2:194639478-194639500 TGTGAAAGACCTCCCAGTAGGGG + Intergenic
944695675 2:202198241-202198263 AGGGCAAGACCTCTCAAAAGAGG + Intergenic
947098319 2:226591848-226591870 TGGGCAAGACCTCCCTGTCGGGG - Intergenic
1170933736 20:20792246-20792268 TGGGCAGCACCTCCCTGAAGGGG - Intergenic
1177902116 21:26929578-26929600 TCTGCAAGATATCACTAAAGTGG + Intronic
1179448833 21:41453756-41453778 TGTACTTGCCCTCCCTAAAGAGG + Intronic
1180133493 21:45844259-45844281 TGTGCAAGACCTCCCTAAAGTGG - Intronic
1180253989 21:46610016-46610038 TGTGATGGACCTCCCTGAAGGGG + Intergenic
1180364367 22:11925631-11925653 TGTACAGGACCTCCCAAATGGGG + Intergenic
1182705004 22:32271472-32271494 TGTGAAGGACCTTCTTAAAGTGG - Intergenic
951283349 3:20779640-20779662 TGGGCAAGAACTCGCGAAAGGGG + Intergenic
954509747 3:51113280-51113302 TAGGCATGACCTCTCTAAAGAGG + Intronic
956671055 3:71690957-71690979 TGTGCAAGACAGCCCTAATCTGG - Intronic
956902930 3:73735780-73735802 CGTGCAAGACATCCCAGAAGTGG + Intergenic
960078418 3:113514803-113514825 TGTGCAAAAGCTCCCGAAAGCGG + Intronic
962902431 3:139773075-139773097 TGTGGCAGACCACCCTAAGGTGG + Intergenic
963756064 3:149235907-149235929 TGGGCAAGACCTCCCAACAGGGG + Intergenic
964065336 3:152570796-152570818 TGAGAAAGACCTCTCTAAAAAGG - Intergenic
966340841 3:178923807-178923829 TGGGCAGGACCTCCCAAATGGGG + Intergenic
968358960 3:198133351-198133373 TGGGCAAGACCTCCCAACAGGGG - Intergenic
972168031 4:36311174-36311196 TGTGCAATTCCTCCCTATAAGGG + Intronic
973394296 4:49580383-49580405 TGTACAGGACCTCCCAAATGGGG + Intergenic
975106288 4:70572166-70572188 TGGGCAAGACCTCCCTACCATGG - Intergenic
978025404 4:103867453-103867475 TGGGCAAGACCTCCCAACGGGGG - Intergenic
981790877 4:148535550-148535572 TGGGTGAGACCTCCCAAAAGGGG - Intergenic
982648748 4:158059256-158059278 TGTGGAAGCCTTCCCCAAAGTGG - Intergenic
983520882 4:168707668-168707690 TCTGCAACACCTTCATAAAGTGG - Intronic
983898964 4:173113054-173113076 TGGGCAGGACCTCCCAAATGGGG + Intergenic
1202763819 4_GL000008v2_random:134553-134575 TGTACAGGACCTCCCAAATGGGG - Intergenic
987874955 5:23669194-23669216 TGTACAAGACTTCCCTCAGGTGG - Intergenic
988708942 5:33754359-33754381 AGTGCAAGTCCTCACTAAATTGG - Intronic
990252932 5:53935434-53935456 TGTGCTAGACACCTCTAAAGAGG - Intronic
991157708 5:63458641-63458663 TGGGCAGGACCTCCCAAATGGGG + Intergenic
992435780 5:76755003-76755025 TGTGTAAGATCTCACTCAAGGGG - Intergenic
993087150 5:83377287-83377309 TGTGCAAAACCACCATAAAATGG + Intergenic
993994728 5:94709210-94709232 TCTGCATGAACTCCCTGAAGAGG - Intronic
999206626 5:149853010-149853032 TGTGCAACAACTCCTCAAAGAGG + Exonic
1000086415 5:157891404-157891426 TCTGAAAGACCTTCCTGAAGAGG - Intergenic
1001517082 5:172363571-172363593 CTGGCAAGACCTCCCTAAGGAGG + Intronic
1001747213 5:174100885-174100907 TGGGCAAGACCTCCCAACATGGG - Intronic
1003264878 6:4556724-4556746 TCTGCAAAACCTCCCTCAAGAGG + Intergenic
1003492948 6:6639810-6639832 TGTGCAGGACCCCCCAAAAGTGG - Intronic
1004541735 6:16557020-16557042 TATGCAAGATCTACATAAAGAGG + Intronic
1006040250 6:31246574-31246596 TGTGCAAGACCTCCCAACCAGGG + Intergenic
1009570249 6:65375086-65375108 TGTGAGAGACCTCCCAACAGAGG + Intronic
1016950661 6:149576668-149576690 TCTGCAATTCCTCCCTCAAGTGG - Intronic
1022628930 7:32067048-32067070 TGTGCAGAACCTCGCTCAAGGGG + Intronic
1023241349 7:38151194-38151216 TATGCAAGACCACCCTGCAGAGG - Intergenic
1023340341 7:39212855-39212877 TTTGCATGAGCTCCATAAAGGGG - Intronic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024743834 7:52384746-52384768 CTTGTAAGACCTCCATAAAGGGG - Intergenic
1024795261 7:53012459-53012481 TATGTAAGACCTCCCAACAGGGG - Intergenic
1031142421 7:117958018-117958040 TGTGGAAGACATGGCTAAAGAGG + Intergenic
1031241337 7:119244992-119245014 TGTGCAAAACCTCCCAACTGAGG - Intergenic
1033186873 7:139234856-139234878 TGTGAAAGACCTCCTGAAAATGG + Intronic
1033668334 7:143465003-143465025 TGTCCATGAGCTCCCTAAAGGGG + Intergenic
1036253838 8:7188179-7188201 CTTGCAGCACCTCCCTAAAGAGG - Intergenic
1036363655 8:8099301-8099323 CTTGCAGCACCTCCCTAAAGAGG + Intergenic
1041756860 8:61323399-61323421 TTTGCAATTCCTCCCTCAAGAGG - Intronic
1042644289 8:70968888-70968910 TGTGTAAGACCTCCCAAAAGGGG - Intergenic
1043593481 8:81856933-81856955 TGTTTAAGTCCTCCCTGAAGAGG - Intergenic
1052515308 9:29472473-29472495 TTGGCAAGACCTCCCTGCAGGGG - Intergenic
1053416410 9:37949615-37949637 TGTGCAAGACGTCCCGAAATGGG + Intronic
1056657824 9:88523488-88523510 TCTGCTAGACCTCCCTAGAAAGG - Intergenic
1060058878 9:120440906-120440928 AGTGAAACACCTCACTAAAGGGG - Intronic
1062743094 9:138192484-138192506 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1062743343 9:138194485-138194507 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1062743592 9:138196486-138196508 TGGGCAAGACCTCCCAACAGGGG - Intergenic
1203544571 Un_KI270743v1:119426-119448 TGTACAGGACCTCCCAAATGGGG - Intergenic
1186915088 X:14210167-14210189 TTTGCAATACCTCCCTAGAGTGG + Intergenic
1187206190 X:17183961-17183983 TGGGGAAGACCTCTCTAAAGAGG - Intergenic
1187646156 X:21349046-21349068 TGGGCAGGACCTCCCTGCAGGGG + Intergenic
1189241506 X:39528071-39528093 TGGGCAAGTCCTCCCTGAATTGG - Intergenic
1189652299 X:43203520-43203542 TGGGCAAGACCTCCCTGTGGGGG - Intergenic
1191155185 X:57266155-57266177 TGAACAAGACCTCCCAACAGGGG + Intergenic
1192960680 X:76127246-76127268 TGGGCGAGACCTCCCTGCAGGGG + Intergenic
1193715143 X:84928092-84928114 TGGGCAGGACCTCCCAAATGGGG - Intergenic
1194947944 X:100091309-100091331 TGGGCAGGACCTCCCAACAGGGG + Intergenic
1194988359 X:100517094-100517116 TGAGAAAGACTTCCCAAAAGAGG + Intergenic
1195844178 X:109208730-109208752 TGGGAGAGACCTCCCAAAAGGGG - Intergenic
1199478780 X:148274461-148274483 TGGGCAAGACCTCCCAAAGGGGG + Intergenic
1200287758 X:154839636-154839658 TGAGGAAGACCTTTCTAAAGAGG - Intronic
1201756750 Y:17494456-17494478 TGGGCAAGACCTCCCAAAAGGGG + Intergenic
1201844803 Y:18411528-18411550 TGGGCAAGACCTCCCAAAAGGGG - Intergenic
1202598642 Y:26570015-26570037 TGAGCAAAACCTTCCTAGAGTGG - Intergenic