ID: 1180134509

View in Genome Browser
Species Human (GRCh38)
Location 21:45853544-45853566
Sequence TACCCTCTGCAGGTTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 3, 2: 53, 3: 91, 4: 213}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180134507_1180134509 5 Left 1180134507 21:45853516-45853538 CCAGCGACAGAATTTTCTGGGGT 0: 1
1: 1
2: 57
3: 92
4: 219
Right 1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG 0: 1
1: 3
2: 53
3: 91
4: 213
1180134503_1180134509 7 Left 1180134503 21:45853514-45853536 CCCCAGCGACAGAATTTTCTGGG 0: 1
1: 0
2: 4
3: 17
4: 208
Right 1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG 0: 1
1: 3
2: 53
3: 91
4: 213
1180134500_1180134509 28 Left 1180134500 21:45853493-45853515 CCCGAGCAAGCAGCTCACGGGCC 0: 1
1: 9
2: 17
3: 46
4: 181
Right 1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG 0: 1
1: 3
2: 53
3: 91
4: 213
1180134501_1180134509 27 Left 1180134501 21:45853494-45853516 CCGAGCAAGCAGCTCACGGGCCC 0: 1
1: 4
2: 16
3: 33
4: 157
Right 1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG 0: 1
1: 3
2: 53
3: 91
4: 213
1180134505_1180134509 6 Left 1180134505 21:45853515-45853537 CCCAGCGACAGAATTTTCTGGGG 0: 1
1: 1
2: 33
3: 95
4: 235
Right 1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG 0: 1
1: 3
2: 53
3: 91
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180134509 Original CRISPR TACCCTCTGCAGGTTTCCAT TGG Intronic
900272181 1:1796655-1796677 GCCCCTCTGCAGGCTTCCAGAGG - Intronic
900788595 1:4665332-4665354 TACACTGTGCAGGCTTCCAGGGG + Intronic
901383414 1:8890477-8890499 TACCCTCTAGAGGTTTCCATTGG - Intergenic
903979941 1:27178507-27178529 TACCCTCTAGAGGTTTCCATTGG - Intergenic
903981113 1:27188934-27188956 TACCCTCTAGAGGTTTCCATTGG - Intergenic
904422402 1:30402682-30402704 TACACTCTGCAGGTCTCTAATGG - Intergenic
905187418 1:36206608-36206630 TACTCTCTAGAGGTTTCCATTGG - Intergenic
905763304 1:40579158-40579180 TACCCTCTAGAGGATTCCATTGG + Intergenic
905984414 1:42265893-42265915 CAGACTCTGCAGGTTTCCAAGGG - Intronic
906588781 1:47004135-47004157 TACCCTTTACAGGTTTCCATTGG - Intergenic
907183272 1:52589421-52589443 TACCCTCTAGAGGTTTCCCTTGG - Intergenic
907511403 1:54963738-54963760 TACCCTCTAGAGGATTCCACTGG - Intergenic
908115989 1:60940774-60940796 TACCATCTAGAGGTTTCCACTGG + Intronic
908934958 1:69363586-69363608 TATCTTCTAGAGGTTTCCATTGG + Intergenic
909013927 1:70363431-70363453 TACCCCCTAGAGGATTCCATTGG - Intronic
909315639 1:74214478-74214500 TACCCTCTAGAGATTTCCACTGG - Intronic
909824885 1:80115511-80115533 TACCTTCTATGGGTTTCCATTGG + Intergenic
910614237 1:89179664-89179686 TACCCTCTAGAGGTTTCCATTGG - Intergenic
910809781 1:91224407-91224429 TACCCCCTAGAGGATTCCATTGG - Intergenic
913282250 1:117197582-117197604 TACCCTCTAGAGGTTTCCATTGG - Intronic
913366277 1:118042759-118042781 TACCCACTAGAGGATTCCATTGG - Intronic
916625730 1:166553117-166553139 TACCTTCTGGAGGTTTCCACTGG - Intergenic
916626236 1:166558260-166558282 TACCCTCCAGAGGTTTCCATTGG - Intergenic
916639822 1:166715881-166715903 TACCCTGTAGAGGTTTCTATTGG - Intergenic
916639974 1:166717345-166717367 TACCCTCTAGAGGTTTCCATTGG - Intergenic
916640682 1:166725649-166725671 TACCCTCTAGACATTTCCATTGG - Intergenic
918629838 1:186703486-186703508 TACCCTCTAGAGGATTCCGTTGG - Intergenic
920768292 1:208854557-208854579 TATCCTCTAGAGGATTCCATTGG - Intergenic
920950605 1:210568641-210568663 TACCCTCTAGAGGTTGCCATTGG + Intronic
921169435 1:212533418-212533440 TACCCTCTAGAGGTTTCTATTGG - Intergenic
922158456 1:223059546-223059568 TACTGTCTGCAGTTTTCCAAAGG - Intergenic
922604688 1:226882204-226882226 TTCCATCTGCAGGGTTTCATAGG + Intronic
923776742 1:236985570-236985592 TACCCTCTGCATTTTTAGATGGG - Intergenic
924627160 1:245705043-245705065 TCCCCTCGGAAGGATTCCATCGG - Intronic
1062932418 10:1362215-1362237 TACCCTCTAGAGATTTCCATTGG - Intronic
1063070854 10:2662434-2662456 TTTCCTCTTCAGGTTTTCATGGG - Intergenic
1063112845 10:3051937-3051959 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1065153582 10:22847379-22847401 TATCCTCTAGAGGTTTCCATTGG + Intergenic
1065428487 10:25630333-25630355 TACCCTCTAGAGGATCCCATTGG - Intergenic
1067348018 10:45451926-45451948 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1069214220 10:65799151-65799173 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1071011692 10:80947767-80947789 TACCCTCTAGAGGATTCCATTGG + Intergenic
1072213564 10:93269017-93269039 TACCCTCTAGAGGTTTCCACTGG + Intergenic
1073822066 10:107275245-107275267 TACCCCCTAGAGGATTCCATCGG + Intergenic
1075190092 10:120299322-120299344 TACCCTCTAGAGGTTTCCGTTGG - Intergenic
1075914561 10:126156440-126156462 TACCCTCTAGAGGTTTCCATTGG - Intronic
1076181550 10:128412875-128412897 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1076908388 10:133374554-133374576 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1077021192 11:417794-417816 TCCCTTCTCCAGTTTTCCATGGG - Intergenic
1077608261 11:3626788-3626810 GGCACTCTGCAGATTTCCATTGG + Intergenic
1078715474 11:13835194-13835216 TACCCTCTGCTGGTTTAAATTGG - Intergenic
1079183102 11:18210994-18211016 TACCCTCTGCAGCTGCCCCTGGG - Intronic
1080384319 11:31801766-31801788 TCCCCTATGCAGGTGTCCAACGG - Exonic
1081179935 11:39972695-39972717 CATCCTCTAGAGGTTTCCATTGG + Intergenic
1083758503 11:64803609-64803631 AACCCTCTGCAGATTTCCTCCGG + Exonic
1083911109 11:65710630-65710652 TACCCTTTGGAGGATTCCATTGG - Intergenic
1084719123 11:70892850-70892872 CACCCTCTGCAGGTTCCCAGAGG + Intronic
1085119651 11:73958890-73958912 TTCACTCTGCTGGTTTCCCTAGG - Intronic
1085240268 11:75047439-75047461 TACCCGCTAGAGGATTCCATTGG - Intergenic
1085333802 11:75674319-75674341 TACCCTCTAAAGGTTTCCATTGG - Intergenic
1085479691 11:76810913-76810935 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1085480619 11:76820035-76820057 TATACTCTAGAGGTTTCCATTGG + Intergenic
1085495262 11:76963190-76963212 CTCCCTCTGCAAGTTTCCATGGG - Intronic
1087050806 11:93884579-93884601 TACCTTCTAGAGGTTTCCATTGG + Intergenic
1088119408 11:106350613-106350635 TACCTTGTTCAGGTTTCCAAAGG + Intergenic
1088287924 11:108206841-108206863 TACCCACTGCAGGTCTCCTGAGG - Intronic
1088714811 11:112539631-112539653 AACCCTCTATAGGTTTCCATTGG + Intergenic
1092864665 12:12749699-12749721 TACCCCCTACAGGTTTCCCATGG - Intronic
1093137319 12:15467968-15467990 CACCATCTGGATGTTTCCATTGG + Intronic
1093357083 12:18179001-18179023 TACCCTCTAGAGGATTCCAGTGG - Intronic
1095215005 12:39538056-39538078 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1096106618 12:48999778-48999800 GCCACTCTGCTGGTTTCCATGGG + Intergenic
1096970945 12:55665859-55665881 TGCCCTCTAGAGGTTTCCACTGG + Intergenic
1098206307 12:68113918-68113940 TACCCTCTGCAGTAGTCCTTGGG - Intergenic
1098313348 12:69169348-69169370 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1098695717 12:73551787-73551809 TACCCTCCAGAGGTTTCCATTGG + Intergenic
1099084761 12:78231934-78231956 TACCCTCTAGAGGATTCCATTGG - Intergenic
1099846678 12:88035854-88035876 GAACCTCTGTAGGTTTCCCTGGG + Intronic
1099994340 12:89761597-89761619 TAGCCTCAGAAGGTTTACATAGG - Intergenic
1101724208 12:107375837-107375859 AAGCCTCTGCAGGTTTGAATAGG - Intronic
1104279431 12:127360871-127360893 TACCCTCTGGAAGTTTCCACTGG - Intergenic
1104309682 12:127643206-127643228 TACCCTCTAGAAGTTTCCACTGG - Intergenic
1106086174 13:26543797-26543819 TGACCTCTTCTGGTTTCCATTGG + Intergenic
1106601585 13:31192147-31192169 TACCCTCTAAAGGTTCCCATTGG - Intergenic
1107522364 13:41195751-41195773 TACCCTCTAGAGGATTCCACTGG - Intergenic
1109783073 13:67138596-67138618 TACCCCCTAGAGGATTCCATTGG - Intronic
1110418086 13:75273945-75273967 TATCCTCTGGAGGTTTCCATTGG + Intergenic
1110925231 13:81142467-81142489 TACCCCCTAGAGGATTCCATTGG - Intergenic
1111594746 13:90396897-90396919 TACCCTCTAAAGGATCCCATTGG - Intergenic
1112370505 13:98788945-98788967 TACCCTCTAGGGGTTTCCACTGG - Intergenic
1112988959 13:105487108-105487130 TACCCTCTGCTGGCTTTCACGGG - Intronic
1114337887 14:21711642-21711664 TATACTCTACAGGTTTCCTTGGG - Intergenic
1114912081 14:27213261-27213283 TACCCTCTTGGGGATTCCATTGG + Intergenic
1114912778 14:27220914-27220936 TACCCTCTAGAAGATTCCATTGG + Intergenic
1114919240 14:27306416-27306438 TACCCTCTAGAGGATTCCTTTGG - Intergenic
1114919862 14:27312729-27312751 TACCCTCTAGAGGATTCCATTGG - Intergenic
1115531974 14:34336018-34336040 TACCCTCTAGAGGTTTCCATTGG + Intronic
1115543110 14:34441360-34441382 TACCCTCTAGAGGATTCCATTGG - Intronic
1115544008 14:34448582-34448604 TATCCTCTAGAGGATTCCATTGG - Intronic
1116397285 14:44461964-44461986 TACCCTCCAGAGGATTCCATTGG - Intergenic
1116465136 14:45223022-45223044 TAGCCCCTGCAGGATTGCATGGG + Intronic
1116576387 14:46581439-46581461 TACCCTCTAGAGGATTCCATTGG + Intergenic
1116577200 14:46588908-46588930 TACCCTCTAGAGGATTCCATTGG + Intergenic
1116725484 14:48557079-48557101 TGCCCTCTAGAGGATTCCATTGG + Intergenic
1116809216 14:49523429-49523451 TGCCCTCTGCAGCTCTCCATGGG + Intergenic
1117128367 14:52657087-52657109 TAACTTCTGCATGTTGCCATGGG - Intronic
1120232004 14:81850208-81850230 TACCCCCTAGAGGATTCCATTGG + Intergenic
1120482589 14:85071040-85071062 TCACCTCTGCTGCTTTCCATTGG - Intergenic
1120680256 14:87472253-87472275 TGTCCACTGAAGGTTTCCATTGG + Intergenic
1121269636 14:92629451-92629473 TACCCTCTAGAGGATTCCATTGG + Intronic
1122547341 14:102531154-102531176 TACTCTCTAGAGGTTTCCATTGG - Intergenic
1122885538 14:104708810-104708832 TGCCCTCTGCAGGCCGCCATGGG + Intronic
1123139523 14:106061761-106061783 AACACTCTCCAGGTTTCCCTGGG + Intergenic
1123144553 14:106116247-106116269 AACACTCTCCAGGTTTCCCTGGG + Intergenic
1125630546 15:41143573-41143595 TACCCCCTAGAGGATTCCATTGG + Intergenic
1126294759 15:47127200-47127222 TACTCTCTTTTGGTTTCCATTGG + Intergenic
1127082443 15:55393860-55393882 TACCCTCTAGAGGCTTCCATTGG - Intronic
1127773640 15:62249576-62249598 TACCCCCTAGAGGATTCCATTGG - Intergenic
1128805166 15:70525452-70525474 TATCCTCTAGAGGTTTCCATTGG - Intergenic
1131184733 15:90265000-90265022 TAACCTCCCCAGGTTTCCAAAGG + Intronic
1132895630 16:2228166-2228188 TATCCTCTGCAGGTCTGCAGGGG - Intronic
1132907154 16:2288522-2288544 CAGACTCTGCAGGTCTCCATGGG + Intronic
1133658507 16:7890961-7890983 TATCCTCTAGAGGTTTCCACTGG + Intergenic
1134006165 16:10819909-10819931 TCCCCACTGCTGGTCTCCATGGG + Intergenic
1135643648 16:24142755-24142777 TACCCTCTGCAGGTCTTCAGGGG + Intronic
1135892055 16:26366112-26366134 TACCCTGTGCTGGGTTCTATGGG + Intergenic
1137283006 16:46993838-46993860 TACCCTCTACAGGTTTCCATTGG - Intergenic
1138033482 16:53579767-53579789 TACCCACTGCAGGTCTCCTCTGG - Intergenic
1138521428 16:57573579-57573601 TATGCTCTAGAGGTTTCCATTGG + Intronic
1140273405 16:73486289-73486311 TACCCTCTAGAGGTTTCCACTGG - Intergenic
1140404818 16:74701835-74701857 TACCCTCTAGAGGCTCCCATTGG - Intergenic
1141089126 16:81117858-81117880 TACCTTCTAGAGGTTTCCATTGG - Intergenic
1142020968 16:87782321-87782343 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1144424977 17:15133249-15133271 TACCCTCTAGAGTTTCCCATTGG + Intergenic
1145998536 17:29118028-29118050 GACCCACTGCAGGTTACCTTTGG + Exonic
1149254124 17:54805485-54805507 TATCCTCTAAAGGTTTCCACTGG - Intergenic
1149476240 17:56963383-56963405 TACCCTCCAGAGGTTTCCACTGG - Intergenic
1150037639 17:61821055-61821077 TACTCTCTAGAGGTTTCCATTGG + Intronic
1151797678 17:76357338-76357360 TACCCTCTAGAGGTTTCCATTGG - Intronic
1151798549 17:76363382-76363404 TACCCTCTAGAAGTTTCCATTGG - Intronic
1151858941 17:76744563-76744585 TACTCTCTGTAGGTTACCACAGG + Intronic
1152134728 17:78497229-78497251 TGTCTTCTGCAGGTTTCCAGAGG - Intronic
1154113061 18:11586846-11586868 TACCCCCTAGAGGATTCCATTGG - Intergenic
1157342206 18:46789335-46789357 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1157833076 18:50875246-50875268 TTCCCTCTGCTGGTTTCTACAGG - Intergenic
1159604032 18:70456657-70456679 TGCCCTCTAGAGGTTTCCACTGG - Intergenic
1160263208 18:77315070-77315092 TACCCTCTAGAGGATTCCGTTGG + Intergenic
1160413951 18:78694601-78694623 TGCCCTCTGCAGGGTACCAGTGG - Intergenic
1162654181 19:12116465-12116487 TACCCTCTGCAAATTTGCAGTGG - Intronic
1162657035 19:12139252-12139274 TACCCCCTGGAGGATTCCATTGG - Intronic
1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG + Intergenic
1163758586 19:19120989-19121011 TACCCTCTGCTGGATTTCACGGG + Exonic
1164616334 19:29668906-29668928 GACCCTCTGCAGGTTCACAAAGG + Intronic
1165841964 19:38793496-38793518 TACCTTCTAGAGGTTTCCATTGG - Intergenic
1166522647 19:43491210-43491232 TACCTTCATCAGGTTTCCAGGGG + Intronic
1168682479 19:58326313-58326335 TACCCTCTAGAGGTTTCCATTGG + Intergenic
925813014 2:7719705-7719727 AACCCTCTAGAGGTTTCCATTGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
928100037 2:28431599-28431621 TACCATCTGCAGGGTGCCAATGG - Intergenic
928308189 2:30188556-30188578 TACCCTCTAGAGGTTTTCACTGG - Intergenic
928965193 2:36968731-36968753 TACCCTCTAGAGGTTTCCACTGG - Intronic
931002763 2:57806831-57806853 GAGCATCTGCAGGTTTCCACTGG + Intergenic
931274490 2:60732737-60732759 TACCTTCTAGAGGTTTCCATTGG + Intergenic
932358287 2:71084880-71084902 TACCCTCTAGAGGATCCCATTGG - Intergenic
932417133 2:71580258-71580280 AACCCTCTGGAGGTTTCCCAGGG - Intronic
933081227 2:77988921-77988943 TACCCTCTAGAGGTTTCCATTGG - Intergenic
933370915 2:81414469-81414491 TACCCTTTTCAGGTTTACATAGG + Intergenic
934818527 2:97351704-97351726 TACCCTCTAGAGGATTCCATTGG - Intergenic
937314261 2:120921111-120921133 TCACCTCTGAATGTTTCCATCGG + Intronic
938137360 2:128770293-128770315 TCCCCTGTGCAGGTGCCCATTGG - Intergenic
938236203 2:129708982-129709004 TACCCTCTAGAGGTTTCCACTGG + Intergenic
938959054 2:136324361-136324383 TACCCTCTAGAGGTTTTCATTGG - Intergenic
940161314 2:150716934-150716956 TGGCCTCTGCACCTTTCCATCGG + Intergenic
940504462 2:154535245-154535267 TACCCTCTAGAGGTTTCCATTGG - Intergenic
942182341 2:173391811-173391833 TACCCTCTAGAGGATTCCATTGG + Intergenic
942375487 2:175332163-175332185 TTCCGTCTGCAATTTTCCATGGG - Intergenic
942806543 2:179937642-179937664 TTCCCTCTGCATCTTGCCATAGG - Intergenic
943743558 2:191437546-191437568 TACCCTCTAGAGGTTTCCACTGG + Intergenic
944048356 2:195438948-195438970 TACCCTCTAGAGGTTTCCACTGG - Intergenic
944194817 2:197041339-197041361 TACCCTCTCCTGGTTCCCATTGG + Intronic
946521086 2:220465540-220465562 TTCCCTCCTCAGGTTTCCAGGGG - Intergenic
946908066 2:224434993-224435015 TACTCTCTAGAGGTTTCCATTGG - Intergenic
946929749 2:224659950-224659972 TAGCCTCTGGAGGGTTCCAATGG - Intergenic
947498287 2:230654606-230654628 TACCCTCTAGAGGTTTCCATTGG + Intergenic
947793445 2:232880363-232880385 TGCCCTCTGCAGGTCTCATTTGG + Intronic
948272327 2:236684039-236684061 TACCCTCTAGAGGTTTCCATTGG + Intergenic
948641508 2:239378548-239378570 TCTCCTCTGCAGGCCTCCATGGG + Intronic
1168898997 20:1343940-1343962 TACCCCCTAGAGGATTCCATTGG + Intronic
1169789256 20:9392353-9392375 TACCCTCTAGAGGTTTCCATTGG + Intronic
1172343897 20:34181614-34181636 TACCCTCTAGAGGATTCTATTGG + Intergenic
1172715479 20:36960209-36960231 TACCCTCTAGGGGTTTCCACTGG - Intergenic
1173288526 20:41694017-41694039 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1174163361 20:48567406-48567428 ATCCCTCTGCAGGTTTCTCTGGG - Intergenic
1175009572 20:55721615-55721637 TACCCTTTAGAGGATTCCATTGG - Intergenic
1175057431 20:56210962-56210984 TACCCTCTAGAGGTTTCCACTGG + Intergenic
1175335380 20:58192762-58192784 TGCCCTCTGCTGGTGTCCCTGGG - Intergenic
1175999811 20:62826755-62826777 TCTCCTCTGCAGGGTCCCATTGG + Exonic
1178018213 21:28376974-28376996 TACCCTCTAGATGTTTCCATTGG - Intergenic
1178117752 21:29435052-29435074 TTCTCTCTAGAGGTTTCCATTGG + Intronic
1178775284 21:35544119-35544141 TAACCTAGGCATGTTTCCATAGG + Intronic
1179449948 21:41461497-41461519 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG + Intronic
1182349921 22:29693583-29693605 TTTCCTCTGGAGGTTGCCATGGG - Intronic
1182695888 22:32199126-32199148 GGCCCTCTCCAGGTTTCCGTGGG + Intronic
1184022086 22:41827586-41827608 TACCCACTAGAGGATTCCATTGG + Intergenic
1184061079 22:42081913-42081935 GACCCTCTGCAGATGTCCTTCGG + Exonic
1184168849 22:42746840-42746862 TACCCTCTAGAGGATTCCATTGG - Intergenic
1185286473 22:50002170-50002192 TGCCCTTTGGAGGTTTCCAGTGG - Intronic
951857385 3:27213061-27213083 TACCCTCTAGAGGTTTCCATTGG - Intronic
952102646 3:30032763-30032785 TACCCACTGAAGGTTGCCCTAGG + Intergenic
955399980 3:58584808-58584830 TACCCTCTAGAGGTTTCCATCGG - Intronic
955524241 3:59804580-59804602 TAGCCTCTAGAGGTTTCCATTGG + Intronic
955729529 3:61969832-61969854 TACCCAGTGCAGCTTTCCAAGGG - Intronic
956469807 3:69554845-69554867 TTCCCTCAGCAGTTTTTCATGGG - Intergenic
958627975 3:96650666-96650688 TACCCTCTAGAGGATTCCATTGG + Intergenic
959596670 3:108136521-108136543 TACCCTTTAGAAGTTTCCATTGG + Intergenic
960442428 3:117705444-117705466 TTACCTCTGCAGGGTTCCAATGG - Intergenic
962245530 3:133788346-133788368 TACCCTCTCAAGGTTTCCATTGG - Intronic
962246270 3:133796507-133796529 TACCCTCTAGAGGTTTCCATTGG - Intronic
962987919 3:140552600-140552622 TGCCCTCTGCTGATTGCCATAGG + Intronic
963171881 3:142259650-142259672 TACCCTCTAGAGGTTTCCATTGG + Intergenic
965902197 3:173656024-173656046 TATCCTCAAGAGGTTTCCATTGG + Intronic
966933227 3:184689191-184689213 GACCCTCTGGAGGATTCTATAGG - Intergenic
966993394 3:185256218-185256240 TACCCTCTAGAGGTTTGCATTGG + Intronic
967242322 3:187452377-187452399 TACCCTCTAGAGGCTTTCATTGG + Intergenic
967588154 3:191239272-191239294 TACCCTCTAGAGGATTCCATTGG + Intronic
968616092 4:1578594-1578616 TAGACTCTGCAGGTCCCCATGGG + Intergenic
969056336 4:4405124-4405146 TCTCCCCTGCAGGTTTCCAAGGG - Intronic
969154834 4:5201336-5201358 TCAGCCCTGCAGGTTTCCATGGG + Intronic
969490913 4:7498807-7498829 CTCCCTCTGCGGGTGTCCATGGG + Intronic
970575176 4:17420122-17420144 TAACCTCTTCAAGTTTTCATTGG + Intergenic
970811049 4:20094437-20094459 TACCCTCTAGAGGTTTCTATTGG - Intergenic
971857240 4:32059272-32059294 TACCCCCTAGAGGATTCCATTGG + Intergenic
971860938 4:32104580-32104602 TACCCTCTAGAGATTTCCATTGG - Intergenic
971980019 4:33740222-33740244 TACACTGTAGAGGTTTCCATTGG - Intergenic
972016859 4:34257660-34257682 TACCATTTGCTGGTTTCTATTGG - Intergenic
972238138 4:37158076-37158098 TACCCTCTAGAGGTTTCCATTGG - Intergenic
973335488 4:48951663-48951685 TAACCTCTAGAGGTTTCCATCGG + Intergenic
974022623 4:56705353-56705375 TACCATCTAGAGGTTTCCATTGG + Intergenic
974479818 4:62428586-62428608 TACCCTCTAGAGTTTTCCATTGG + Intergenic
975336815 4:73187570-73187592 TCCCCTCTAGAGGATTCCATTGG - Intronic
976259605 4:83133490-83133512 TACCATCTAGAGGATTCCATTGG + Intronic
976638781 4:87315215-87315237 TACCCCCTAGAGGTTTCCACTGG - Intronic
977555885 4:98486975-98486997 TGCCCTCTGAAGGTTTTCTTTGG - Intronic
978261914 4:106769881-106769903 TACTCTTTTCTGGTTTCCATTGG - Intergenic
978337200 4:107682123-107682145 TACCTTTTGCAGGTTTCACTGGG - Exonic
978588919 4:110303217-110303239 TACCCTCTAGAGGATTCCATTGG - Intergenic
979619935 4:122787519-122787541 TACCCTCTAGAGGATTCCACTGG + Intergenic
981696648 4:147565440-147565462 TACACTCTAGAGGTTTCCAGTGG + Intergenic
981989647 4:150902585-150902607 TAACCTTTAGAGGTTTCCATTGG - Intronic
984017766 4:174446064-174446086 TACCCTCTAGAGGATTCCACTGG - Intergenic
984789828 4:183605309-183605331 TACCCTCGAGAGGTTTCCATTGG - Intergenic
985061734 4:186086971-186086993 TACTCTCTAGAGGTTTCCATTGG + Exonic
985541790 5:490818-490840 TGCCCTCGGCAGCTTTCCCTGGG + Intronic
986369837 5:7068880-7068902 TACCCTCTAGAGGTTTCCATTGG + Intergenic
986539328 5:8827581-8827603 TACCCTCTAGAGGTTTCTGTTGG + Intergenic
986759523 5:10867700-10867722 TACTCTCTAGAGGTTTCCATTGG - Intergenic
988599169 5:32623616-32623638 TACCCTCTAGAGGTTTCCACTGG - Intergenic
989412711 5:41139123-41139145 TACCCTCTAGAGGTTTCCATTGG + Intergenic
989735225 5:44695473-44695495 TACCCTCTAGAGGTTTCCACTGG + Intergenic
993260496 5:85651842-85651864 TAGCCTCTAGAGGTTTCCATTGG + Intergenic
993321684 5:86477478-86477500 TAACCTCTAGAGGTTTCCAATGG + Intergenic
994140593 5:96336576-96336598 TGCCCTCTAGAGGTTCCCATTGG + Intergenic
994521387 5:100841496-100841518 TACCCTCTAGAGGTTTCCATTGG - Intronic
994631933 5:102297090-102297112 TACCCCCTAGAGGATTCCATTGG + Intergenic
994833780 5:104821496-104821518 TACCGTCTACATTTTTCCATTGG + Intergenic
995809240 5:116086086-116086108 TACCCTCTAGAGGATTCCATTGG + Intronic
996099785 5:119434564-119434586 TACCCTCTAGAGGTTTCCATTGG - Intergenic
996853266 5:127976620-127976642 TACCCTCTAGAGGCTTCCATTGG + Intergenic
997295268 5:132764906-132764928 GTCCCTCTGCAGGTGTCCTTCGG - Intronic
997384268 5:133460083-133460105 TACCCTCTAGAGGATTCCATTGG - Intronic
997593657 5:135091812-135091834 GCCCATCTTCAGGTTTCCATGGG - Intronic
999397952 5:151242443-151242465 TACCCTCTAGAGGTTTCCATTGG + Intronic
1001453923 5:171846548-171846570 GGCCCTCTGCAGGTTTTCACAGG - Intergenic
1004538738 6:16528359-16528381 TATCCTCTGAAGGTATACATGGG + Intronic
1005236955 6:23775318-23775340 TACCTCCTGCAGCTTTCCAATGG - Intergenic
1007156760 6:39752652-39752674 AATCCTCTAGAGGTTTCCATTGG - Intergenic
1008215331 6:48781194-48781216 TACTCTTTGTTGGTTTCCATTGG - Intergenic
1008371122 6:50731844-50731866 TACCATCTGCAGAGTTCCAGGGG - Intronic
1010691502 6:78916102-78916124 TACCCTCTAGAGGTTTCCATTGG + Intronic
1010939738 6:81902462-81902484 TACCCTCTGCAAGTATCATTTGG + Intergenic
1011324632 6:86136065-86136087 GACTCTCTGCAGGGTCCCATAGG + Intergenic
1012952956 6:105538600-105538622 TCCCCTCTGTAAGTTTCCACAGG + Intergenic
1013104241 6:107013040-107013062 TACCCGCTAGAGGATTCCATTGG + Intergenic
1013807142 6:114008572-114008594 TACCCTCTAGAGGATTCCACTGG + Intronic
1016225338 6:141728439-141728461 CACCCTCTAGAGGTTTCCACTGG + Intergenic
1017493206 6:154962033-154962055 CACTCTCTGCAGGTTCCCATCGG + Intronic
1018514887 6:164568741-164568763 TACGCTCTAGAGGTTTCCATTGG + Intergenic
1018582527 6:165319444-165319466 TACTTTCTAGAGGTTTCCATTGG - Intergenic
1018619182 6:165714260-165714282 CCCCCTCTGCAGGCTCCCATCGG - Intronic
1018620812 6:165727630-165727652 TACTCCCTGCAAATTTCCATAGG - Intronic
1019810579 7:3162458-3162480 TACCCTCTACTGGGCTCCATGGG - Intronic
1021359974 7:19700608-19700630 TCCCCACTGCAGGATTCCTTAGG + Intronic
1022191460 7:28020360-28020382 TTCCCTGTGCCGTTTTCCATGGG - Intronic
1022216184 7:28264066-28264088 TGTCCTCTAGAGGTTTCCATTGG - Intergenic
1022472844 7:30692357-30692379 TGCCCTCAGCAGCTTTCCCTCGG + Intronic
1026620921 7:71949363-71949385 AACCCTCTCGAGGTTTCCATTGG - Intronic
1026832912 7:73621351-73621373 CACCCTCTGCAGGTTAGCGTGGG - Intronic
1027719172 7:81716973-81716995 TTCCCTCAGAAGATTTCCATTGG - Intronic
1028035462 7:85976389-85976411 TACCCCCTACAGGATTCCATTGG + Intergenic
1028415055 7:90570818-90570840 TCCCCTCTGCTGGTTCCCAAGGG + Intronic
1030143830 7:106332584-106332606 TACCCTCTAGAGGTTTCTGTTGG - Intergenic
1032311840 7:130794682-130794704 TACCCTCTGGAGGATTCTGTTGG + Intergenic
1032673534 7:134107414-134107436 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1033072204 7:138214428-138214450 TACCCTCTAGAGGTTTCTATTGG + Intergenic
1033141496 7:138831056-138831078 TACCCTCTAGGGGTTTCCATTGG - Intronic
1033850553 7:145489169-145489191 TACTCTCTAGAGGATTCCATTGG + Intergenic
1034653561 7:152711713-152711735 TACCCTCTGGAGGTTTCCATTGG - Intergenic
1034684033 7:152954117-152954139 TACCCTCTAGAGGTTTCCACTGG + Intergenic
1034736347 7:153432601-153432623 TACCCTCTGGAGGTTTCCATTGG + Intergenic
1037411347 8:18601600-18601622 TCCACCCTGCAGGTTTCCAAGGG + Intronic
1038052817 8:23829627-23829649 TCCCCTATGCCGGTTTCCACTGG + Intergenic
1038382870 8:27113231-27113253 TACCCTCTAGAGGATTCCACTGG - Intergenic
1038404955 8:27314618-27314640 TACCCTCTGGAGGACTCCATTGG - Intronic
1038439391 8:27560972-27560994 GACCAACTACAGGTTTCCATGGG - Intergenic
1039297129 8:36168903-36168925 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1041134228 8:54739010-54739032 TACCCTCTGCAAGTTCCACTCGG - Intergenic
1044149144 8:88752170-88752192 TGCCCTCTGCAGGTGTCTAGTGG - Intergenic
1045288536 8:100812344-100812366 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1045545278 8:103122874-103122896 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1046486619 8:114895906-114895928 TACCCTCTAGGGGTTTCCATTGG - Intergenic
1046487266 8:114902863-114902885 TAATCTCTAGAGGTTTCCATTGG - Intergenic
1047073920 8:121378526-121378548 TACCCTCTAGAGGTTTCCATCGG - Intergenic
1048101957 8:131361804-131361826 TACTCCCTGTAGCTTTCCATGGG - Intergenic
1048369665 8:133766523-133766545 TACCCTCTAAGGGTTTCCACTGG - Intergenic
1050139422 9:2502103-2502125 TACCCTCTAGATGATTCCATTGG + Intergenic
1054771656 9:69089464-69089486 TACCCTCTAGACGATTCCATTGG - Intronic
1056394151 9:86166295-86166317 TACCCTCTAGAGGTTTCCATCGG - Intergenic
1057090914 9:92257471-92257493 TGCACTCTGCAGGTCTCCACTGG - Intronic
1059689687 9:116673126-116673148 TACCCTCTAGATGATTCCATTGG - Intronic
1061193354 9:129094722-129094744 TGCCCTCTTCAGCTTTCCCTGGG - Intergenic
1061620249 9:131807255-131807277 TCCAGTCTGAAGGTTTCCATAGG + Intergenic
1185890820 X:3820314-3820336 TACCCTCTCCAGCTATGCATTGG + Intronic
1186166082 X:6827408-6827430 TACCCTCTAGAGGATTCTATTGG + Intergenic
1186831603 X:13395986-13396008 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1189415833 X:40812624-40812646 TACCCTCTAGAGGTTTCCATTGG + Intergenic
1189416364 X:40817589-40817611 TACCCTCTAGAGGTTTCCACTGG + Intergenic
1189677115 X:43472813-43472835 TACCCTCTAGAGGTTTCCACTGG + Intergenic
1189756081 X:44272486-44272508 TACCCTCTGCATGTCAACATTGG - Intronic
1189815178 X:44817593-44817615 TACCCTCTAGAGATTTCCATTGG + Intergenic
1190408463 X:50111151-50111173 TACCCTTTAGAGGTTTCCATTGG + Intergenic
1190511396 X:51177246-51177268 GACCCTCAGCTGGATTCCATGGG + Intergenic
1192121591 X:68461326-68461348 TACCCTTTAGAGGTTTCCATTGG + Intergenic
1192789291 X:74365468-74365490 TACCCTCTGGATGTTGTCATTGG - Intergenic
1194090217 X:89576000-89576022 TACCCCCTAGAGGATTCCATTGG - Intergenic
1194135637 X:90137696-90137718 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1195143361 X:101986892-101986914 TACCCTCTAGAGGATTCCATTGG - Intergenic
1195373944 X:104207204-104207226 TACCATCTGCTGGTTTCTAATGG + Intergenic
1195899344 X:109781196-109781218 TACCCTCTCCAGGATTCCATTGG - Intergenic
1196400644 X:115312589-115312611 TACCCTCCAGAGGTTTCCATTGG + Intergenic
1196464308 X:115957659-115957681 TACCCTCTAGAGGTTTCTATTGG - Intergenic
1196973325 X:121132902-121132924 TACCCCCTAGAGGATTCCATTGG + Intergenic
1196974411 X:121142509-121142531 TACCCTCTAGAGAATTCCATTGG + Intergenic
1197210209 X:123822032-123822054 TACCCTCTAAGGGTTTCCATTGG - Intergenic
1197790373 X:130248535-130248557 TAGGCTCTGCTTGTTTCCATAGG + Intronic
1198045762 X:132900994-132901016 TGCCCTATGCAGAGTTCCATGGG + Intronic
1198092549 X:133346012-133346034 TACCCCCTAGAGGTTTCTATTGG + Intronic
1198294501 X:135272872-135272894 TACCTTCTAGAGGTTCCCATTGG - Intronic
1200037386 X:153340802-153340824 TACCCTCTTTAGGTTTTCAAGGG + Intronic
1200481403 Y:3707777-3707799 TACCCTCTAGAGGTTTCCATTGG - Intergenic
1201355644 Y:13094359-13094381 TGCCCTCTTGAGGTTTCCATTGG + Intergenic