ID: 1180137467

View in Genome Browser
Species Human (GRCh38)
Location 21:45871003-45871025
Sequence AGGGAGAGCCCAGCACCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 266}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180137461_1180137467 4 Left 1180137461 21:45870976-45870998 CCAGGGGAGGCTGTATAGCCCAG 0: 1
1: 0
2: 2
3: 24
4: 185
Right 1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 266
1180137460_1180137467 5 Left 1180137460 21:45870975-45870997 CCCAGGGGAGGCTGTATAGCCCA 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 266
1180137454_1180137467 21 Left 1180137454 21:45870959-45870981 CCAGGAAATGGGGGCCCCCAGGG 0: 1
1: 0
2: 2
3: 37
4: 325
Right 1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 266
1180137458_1180137467 7 Left 1180137458 21:45870973-45870995 CCCCCAGGGGAGGCTGTATAGCC 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 266
1180137452_1180137467 25 Left 1180137452 21:45870955-45870977 CCAGCCAGGAAATGGGGGCCCCC 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 266
1180137459_1180137467 6 Left 1180137459 21:45870974-45870996 CCCCAGGGGAGGCTGTATAGCCC 0: 1
1: 0
2: 0
3: 20
4: 146
Right 1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG 0: 1
1: 0
2: 3
3: 19
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180137467 Original CRISPR AGGGAGAGCCCAGCACCCGC TGG Intronic
900158631 1:1213249-1213271 AGGGAGGGCCCAGGAGCCTCGGG - Intronic
900462090 1:2806430-2806452 AGGGAGAGCCCAGCTTCCCCCGG + Intergenic
900514249 1:3073795-3073817 GGGGAGAGCGCCGCTCCCGCTGG - Intronic
900617710 1:3572789-3572811 AGGGAGGACCCAGCACACCCAGG - Intronic
900617795 1:3573118-3573140 AGGGAGGACCCAGCACACACAGG - Intronic
901055063 1:6445501-6445523 AGGGGAAGCCCAGCACCGCCAGG + Intronic
901474649 1:9481168-9481190 GGAGAGAGGCCAGCACCTGCTGG - Intergenic
901477622 1:9501642-9501664 AGGGTGACACCAGCACCCCCAGG + Intergenic
901490931 1:9595838-9595860 TGGAAGACCCCAGCACCTGCTGG - Intronic
901630191 1:10644197-10644219 AGGAAGAGACCAGAACCCACGGG - Intronic
901684287 1:10935068-10935090 ATGGTGAGCCCAGGACCCTCTGG - Intergenic
901741792 1:11346534-11346556 AGGGAGGGGCCAGAACACGCAGG + Intergenic
901924048 1:12554751-12554773 AGGGAGCGCCCAGGGCCAGCAGG + Intergenic
902286577 1:15411424-15411446 AGAGAGGGCCCAGCTCCCTCCGG + Intronic
902437696 1:16409078-16409100 AGGGAGGTCCCAGCACAGGCAGG - Intronic
903069345 1:20718869-20718891 AGGAAGAGCCCAGCGCCCAGAGG - Intergenic
903446333 1:23424757-23424779 GGGGAGAGCCCCGCCCCCGCCGG - Intergenic
904286418 1:29455537-29455559 TGGGAGAGCCCAGCACTGGAGGG + Intergenic
904316774 1:29670867-29670889 AGGGAGAACCCAGGGCCCGCCGG + Intergenic
905169209 1:36099432-36099454 AGGGAGAGCCCGGCCCCCCTGGG - Exonic
907247613 1:53117970-53117992 AGGGAGAGGTGAGCAGCCGCGGG + Intronic
907827876 1:58036335-58036357 AGGGAGAGCCCAGGGCCCGTGGG + Intronic
908572060 1:65420595-65420617 ACGCAGAGCCCCGCCCCCGCCGG - Exonic
909360419 1:74752711-74752733 AAGGACAGCCCAGCAGCCACAGG + Intronic
911193793 1:94973700-94973722 AAGGAAAGCCAAGCAGCCGCAGG - Intergenic
912601013 1:110933545-110933567 AGGGAGAGCACAGCAATTGCGGG + Intergenic
913322565 1:117599465-117599487 AGGGAGAGTCTATCACCAGCAGG + Intergenic
915915314 1:159937145-159937167 GGGGAGAGCCAAGCCCCCTCAGG + Intronic
916914450 1:169391374-169391396 AGGGGGATCCCAGCAGCTGCAGG - Intronic
918070707 1:181131715-181131737 AGGGTGAGCTCAGCACCTGGCGG - Intergenic
919780062 1:201215877-201215899 AGGGAGGGCCCAGAACCCCAGGG - Intronic
920430746 1:205917329-205917351 AAGGAGAGCTCAGCATCCCCTGG + Exonic
921714021 1:218400441-218400463 AGGGGGACCCCAGCAGCTGCTGG - Intronic
921954046 1:220963527-220963549 AGGAAGAGCCCAGCATCCTGGGG + Intergenic
923358874 1:233188239-233188261 AGGCAGAGCTCAGCTCCCCCTGG + Intronic
923622238 1:235588363-235588385 TCGGAGAGCACAGCCCCCGCTGG - Intronic
923625604 1:235611493-235611515 ATGTAGTGCCCAGCACCAGCAGG + Intronic
924669987 1:246114385-246114407 AGGAAGAGGCCAGCCCCCGATGG + Intronic
1063088577 10:2841533-2841555 AGGGAGAATCCTGCACCCACCGG + Intergenic
1063091004 10:2866308-2866330 AGAGAGGGCCCAGCACCCCGAGG + Intergenic
1063373716 10:5539142-5539164 AGGGAGAGCCCAGGGCAAGCCGG + Intergenic
1065390368 10:25175917-25175939 AGGGCGAGCCCAGCATCTCCCGG + Exonic
1065495042 10:26318977-26318999 AGGGCGAGCACAGGACCTGCAGG + Intergenic
1066708133 10:38203221-38203243 AGGGAGAGCACAGCAACTGTGGG + Intergenic
1067346589 10:45442715-45442737 TGGGGGACCCCAGCACCAGCGGG - Intronic
1068440828 10:57053278-57053300 AGGGAGAGGCCAGCAGACTCAGG - Intergenic
1070890561 10:79939995-79940017 AGGTAGAGCCCAGCAGTGGCTGG + Intronic
1072622752 10:97090804-97090826 TGCCAGGGCCCAGCACCCGCTGG - Intronic
1073578281 10:104642352-104642374 AGGGGGAGCCCGGCAGCCGCAGG - Intronic
1073639916 10:105241355-105241377 AGGGGGAGCGCAGCAGCCCCAGG + Intronic
1074441310 10:113479542-113479564 AGTCAGACCCCAGCACCCTCAGG - Intergenic
1076260262 10:129059497-129059519 AGAAAGAGCCCTGCACCAGCTGG - Intergenic
1076492871 10:130875392-130875414 AGGGAGAGCCCACCTCCAGCTGG + Intergenic
1076519366 10:131071137-131071159 GAGGGGAGCCCAGCACCGGCGGG + Intergenic
1076613744 10:131743089-131743111 TGGGGGAGCCCAGCACCCCTTGG - Intergenic
1076680157 10:132167692-132167714 AGGGAGAGCCCTGCTCCCAGGGG - Intronic
1076728984 10:132429055-132429077 AGGGAAAGCCCAGCTCCATCAGG + Intergenic
1076804864 10:132850297-132850319 CGGGAGGGCCCTGCACCTGCTGG - Exonic
1077161745 11:1116454-1116476 GGGGACAGCCCAGCACACTCAGG - Intergenic
1078100821 11:8329329-8329351 AGGAGGAGCCCAGCACCCCGGGG + Intergenic
1078821941 11:14891768-14891790 AGGGGGAGCCCCGCCCCTGCCGG - Intronic
1080384865 11:31805269-31805291 GGGGAGAGCCCAGCCGCCGAAGG + Intronic
1081493411 11:43583618-43583640 AGGGAGAGATCAGCTCCCACTGG - Intronic
1081721773 11:45294623-45294645 AGGGAGAGTCCAGAAACCCCTGG + Intergenic
1083620743 11:64048215-64048237 GAGGAGAGCTCAGCTCCCGCCGG + Intronic
1084183577 11:67458562-67458584 AGGCTGAGCCCAGCACCTCCTGG + Intronic
1084278148 11:68066972-68066994 AGGGAGAGCTCAGCTGCCACAGG + Intronic
1084315233 11:68341942-68341964 GGCGAGTGCCCAGCACCAGCTGG - Intronic
1084413126 11:69015319-69015341 AGGGAGGGCCTGGCACCAGCGGG - Intergenic
1084906203 11:72349863-72349885 AGGGAGAGGTCAGCATCGGCTGG - Intronic
1085182368 11:74546597-74546619 GGGGAGAGTCCAGCAGCGGCGGG + Intronic
1085223332 11:74895259-74895281 ATGGAGAGCACAGCAACCGAGGG + Intronic
1086032990 11:82383213-82383235 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1087686660 11:101273050-101273072 AGGGAGAGGCCAGCTGCCCCTGG - Intergenic
1087847781 11:102992997-102993019 AGTGAAAGGCCAGCACACGCTGG + Intergenic
1090331811 11:125938687-125938709 TGAGAGACCCCAGCACCAGCTGG + Intergenic
1091407675 12:219475-219497 AGATTGAGCCCAGCACCCTCGGG + Intergenic
1097960147 12:65524297-65524319 AGGGAGAGCCCAGATCATGCAGG + Intergenic
1100476347 12:94939142-94939164 AGGCAGAGCCCAGCTCATGCTGG + Intronic
1104877314 12:132044713-132044735 AGGGAGAGGGCAGCACTCACCGG - Exonic
1107210756 13:37851829-37851851 AGGGAGAGCACAGCAACAGGTGG + Intronic
1107930756 13:45305377-45305399 AGGGAGAGGCCAGCATCATCAGG + Intergenic
1118729159 14:68654620-68654642 AGGAAGTGCCAAGCACCCACGGG - Intronic
1120843565 14:89107432-89107454 CGGCAGAGCCCAGCACCCACTGG - Intergenic
1121330487 14:93046571-93046593 AGGGATGGCCCAGCAGCCGGGGG + Intronic
1121639025 14:95473002-95473024 AGAGAGACCCCAGCACCCGGGGG + Intronic
1122942104 14:104986039-104986061 AGCGAGAGCCGGGCGCCCGCGGG - Exonic
1123475813 15:20592153-20592175 AGGGAGAGCTCTGCACCTGCAGG - Intergenic
1123642198 15:22408210-22408232 AGGGAGAGCTCTGCACCTGCAGG + Intergenic
1123723638 15:23081593-23081615 AGGAAGATCCCAGCATCAGCGGG - Intergenic
1124253288 15:28121699-28121721 TGGAAGAGCCCAGCACACACAGG + Intronic
1128921638 15:71615839-71615861 AGGTTGAGCCCAGCACCCCAGGG + Intronic
1128972203 15:72117810-72117832 AGGGTGGGCCCAGCAGCCTCAGG + Exonic
1130062206 15:80578175-80578197 AGGGAGAGCACAGCAGCAGGAGG + Intronic
1130441259 15:83956217-83956239 AGGGAGAGCACAGCAACTGGGGG - Intronic
1130788361 15:87124550-87124572 AGCGTGAGCACAGCCCCCGCTGG - Intergenic
1132065510 15:98727742-98727764 CGGGTGGGTCCAGCACCCGCTGG + Intronic
1132404792 15:101535768-101535790 AGGGAGAGACCAGCAGCCAGTGG + Intergenic
1132559484 16:586914-586936 CCGGGGAGCCCAGCAGCCGCCGG - Intergenic
1132664008 16:1073429-1073451 AGGCAGAGGCCAGCACCCAGGGG + Intergenic
1132897075 16:2234128-2234150 AGGCCAAGCCCATCACCCGCGGG - Intronic
1136242428 16:28952221-28952243 AGGGAGAGGCACGCAGCCGCTGG + Intronic
1136418373 16:30117079-30117101 TGTGTGAGCCCAGCAGCCGCTGG - Intronic
1137548129 16:49418149-49418171 AGGCAGAGCGCAGAACCCGTGGG + Intergenic
1138487840 16:57358175-57358197 AGGGAGAGCCCGGCAGCCACTGG + Intergenic
1140456848 16:75110777-75110799 AGGGAGAGCGCAGCTGCTGCAGG + Exonic
1141495778 16:84408422-84408444 GGGCAGAGCCCAGCAGCAGCAGG - Exonic
1141797884 16:86286930-86286952 AGGGAGGGCCGAGCAGCTGCAGG - Intergenic
1141882373 16:86868375-86868397 AGGGAGAACCCATCACACGGAGG + Intergenic
1142119795 16:88381628-88381650 AGGGAGATCCCAGGACCTGGAGG + Intergenic
1143563444 17:7708330-7708352 AGGGAGATCCCAGTGCCCTCAGG + Intronic
1143780421 17:9226103-9226125 AGCCAGAGCCCAGCTCCCGTAGG + Intronic
1144217905 17:13072703-13072725 AGGGAGAACGCAGCACCAGGTGG - Intergenic
1145963718 17:28902535-28902557 ACGGTGAGCCGAGAACCCGCCGG - Intronic
1146656604 17:34638434-34638456 AGGAAGAGCCCTCCACCTGCAGG - Exonic
1146907088 17:36624734-36624756 AAGAAGAGCCCAGGACCCCCAGG - Intergenic
1147013326 17:37469687-37469709 GTGTAGAGCCCAGGACCCGCCGG + Intronic
1150135931 17:62695138-62695160 AGGGAGAGCCCATGAGCTGCTGG + Intergenic
1150306981 17:64093887-64093909 AGGGAGAGCACAGCTCCCCAGGG + Intronic
1151219929 17:72604809-72604831 AGGGCGAGGCCTGCACCCTCGGG + Intergenic
1152075839 17:78159035-78159057 TGGGAGAGCCCTGCCCCCACGGG + Intronic
1152217582 17:79042714-79042736 AAGGAGAGTCCATCAGCCGCTGG - Intronic
1152461779 17:80445574-80445596 CGGGAGAGGCAGGCACCCGCCGG + Intergenic
1154085983 18:11305889-11305911 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1159422959 18:68247153-68247175 ATGAAGTGCCCAGCACCCTCAGG + Intergenic
1159770973 18:72544480-72544502 AGGGAGGCCCGGGCACCCGCAGG - Exonic
1160215038 18:76921260-76921282 AGAGAGAGCCCAGGTCCCACTGG + Intronic
1160411897 18:78680876-78680898 CGAGAGAGCCCACCACCAGCCGG + Intergenic
1160509332 18:79444501-79444523 AGGGAGACCCCAGGCCCCTCAGG + Intronic
1160735142 19:658952-658974 AGGCAGACCCCAGCGCCAGCCGG + Intronic
1161415879 19:4146011-4146033 AGGGACAGCCGGGCATCCGCTGG + Intergenic
1161593479 19:5139540-5139562 GGGGAAAGCCCTGCACCCGGGGG - Intronic
1161984885 19:7647633-7647655 AGGGACAGCCCCACACCAGCCGG + Intronic
1163112580 19:15170420-15170442 AGCGCGAGCACAGCACCCTCTGG - Exonic
1163577972 19:18121790-18121812 AGGCAGGACACAGCACCCGCTGG - Intronic
1163833318 19:19558316-19558338 AGGGAGAGGGCAGGACCTGCCGG - Intergenic
1167169463 19:47821704-47821726 AGGGAGGCCCCAGCTCCTGCCGG - Intronic
1167263075 19:48469809-48469831 CGGGCGAGCCCAGCGCCTGCCGG + Intronic
926075515 2:9939729-9939751 AGGGAGAGCCCAGGGTCCTCAGG + Intergenic
926229249 2:10990378-10990400 AGAGAGGGCCCAGCAGCCCCAGG + Intergenic
927210124 2:20634100-20634122 AGGGAAAGCCCAGCCCGAGCAGG + Intronic
927889431 2:26739070-26739092 GTGCAGAGCCCAGCACCCCCAGG + Intergenic
933063440 2:77767524-77767546 AGTGAGAGCCAAGCACAAGCAGG + Intergenic
935750840 2:106232568-106232590 AGGGAGAGCACAGCAACTGGAGG + Intergenic
937348477 2:121143235-121143257 CGGGAGGGCCCAGCACACCCTGG + Intergenic
938898160 2:135773351-135773373 CAGGAGAGCCCAGCACCTCCTGG + Intronic
939085049 2:137708495-137708517 AGGAAGACCCCTGCACCCACAGG - Intergenic
939223436 2:139334699-139334721 AGGAAAAGCCCAGCACCTGATGG + Intergenic
940012966 2:149073859-149073881 AGGGAGAGGACAGCAACCTCGGG + Intronic
943373442 2:187045559-187045581 AGGGAGAGACCAGGACCAGGTGG + Intergenic
945529116 2:210927685-210927707 AGTGAGAGCACAGCACGTGCAGG - Intergenic
947877442 2:233477139-233477161 TGAGAGAGCCCAGCACCTACTGG + Exonic
948047009 2:234952378-234952400 AGGGAGACCCGAGCGCCCGGGGG - Intronic
948307919 2:236963574-236963596 AGGGAAACCCCAGCACACACAGG + Intergenic
948771190 2:240251951-240251973 AGGGCCAGCCCAGCACCCCTGGG - Intergenic
1168831107 20:845666-845688 CGGGAGAGCCCAGCAGCTGAAGG + Exonic
1169784356 20:9343051-9343073 TGGGAGAGTCCAGCACTCCCTGG + Intronic
1172608553 20:36232069-36232091 AGGGAGGTCACAGCATCCGCGGG - Exonic
1172922403 20:38496154-38496176 AGGAAGAGCCAAGCACCTCCAGG - Intronic
1173878789 20:46394959-46394981 AGGAAGATCCCAGCATCAGCAGG + Intronic
1174591864 20:51652251-51652273 AGGGAGGGCCCAGCGCCCCCAGG + Intronic
1175911556 20:62407511-62407533 AGCGAGAGCCCCGCGGCCGCAGG - Intergenic
1176308471 21:5136681-5136703 GGGCAGTGCCCAGCACACGCTGG - Intronic
1176311732 21:5154302-5154324 GGGGAGGGCACAGCACCCTCGGG - Intronic
1177212768 21:18091042-18091064 AGGGAAAGCACAGCACCTGGGGG + Intronic
1177871001 21:26572970-26572992 AGGGAGAGCCCGGAACCGGAGGG + Exonic
1178881602 21:36454324-36454346 AGGGAAGGCCCAGCCCCTGCGGG - Intergenic
1178902242 21:36606823-36606845 AGAGAGAGCCCTGCATCCACAGG - Intergenic
1179289772 21:40008233-40008255 AGGCAGAGTCCAGCACTCTCTGG + Intergenic
1179520737 21:41942776-41942798 AGGGAGAGGCCAGCCCCTGGGGG - Intronic
1179845318 21:44107733-44107755 GGGGAGGGCACAGCACCCTCGGG + Intronic
1179848588 21:44125351-44125373 GGGCAGTGCCCAGCACACGCTGG + Intronic
1180137467 21:45871003-45871025 AGGGAGAGCCCAGCACCCGCTGG + Intronic
1180233437 21:46442053-46442075 ACGGAGACCCCAGCCCTCGCAGG - Intronic
1180999192 22:19980106-19980128 AGGGCGAGCGCCGCACCAGCCGG + Exonic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1184152905 22:42649029-42649051 CGCCAGAGCCCAGCACCCGGGGG - Intronic
1184164168 22:42717609-42717631 AGAGAGAGCTCAGCTCCCTCAGG - Intronic
1184593690 22:45502338-45502360 CGGGTGAGCCCAGCACACGTTGG + Intronic
1184979207 22:48084227-48084249 AGGGAGAGACCAGAACTCGGGGG + Intergenic
1185038351 22:48490908-48490930 AGGGAGACCCGGGCAGCCGCGGG + Intronic
1185312278 22:50162763-50162785 AGAGAGAGTCCAGCAAACGCTGG - Intergenic
949936783 3:9121843-9121865 AGGGAGAGCCCAAGACTTGCTGG + Intronic
950194205 3:10997646-10997668 AGGGAGAGGGCAGCAGCCACAGG + Intronic
951558736 3:23945631-23945653 AGGGAGCGCTCAGAGCCCGCGGG + Intronic
953932616 3:47013237-47013259 AGGCTGAGCCCAGCAACCCCAGG - Intergenic
954686477 3:52372859-52372881 TGTGTGAGCCCAGCACCCACAGG - Intronic
954810037 3:53241980-53242002 AGGGAGAGGCCAGGACGAGCAGG + Intronic
955228343 3:57079012-57079034 AGGGAGCGCTCAGGGCCCGCCGG + Intronic
956698117 3:71935851-71935873 GGGGAGAGTCCAGCAGCAGCGGG + Intergenic
964720691 3:159764968-159764990 AGGCAGAGCCCCCCAGCCGCCGG - Exonic
968292235 3:197547706-197547728 AGGGAGAGGCCAGCCCCCACGGG - Intronic
968616329 4:1579266-1579288 AGGGGGCGCCCAGCAGGCGCGGG - Intergenic
969592044 4:8127595-8127617 AGGGAGAGCCGCCGACCCGCTGG - Intronic
973227407 4:47802003-47802025 AGGGAGAGCACAGCAACTGGGGG + Intronic
973763206 4:54139672-54139694 AGGGAGAGCACAGCAACCGGGGG + Intronic
973967386 4:56177636-56177658 AGGGAAAGCCCAGAACCTGATGG - Intronic
975629561 4:76386777-76386799 AGGGAGAGCACAGCAACTGGGGG + Intronic
977145951 4:93440050-93440072 AGGGAGAGCCCACCACCCACTGG + Intronic
978082626 4:104612790-104612812 AGGAAAAGCCCAGGACCCGATGG - Intergenic
981686535 4:147460709-147460731 AGGGACAGCCAAGCTCCCTCAGG - Intergenic
985536219 5:467101-467123 CGGCAGAGCCCTGCACCCACAGG - Exonic
985615923 5:922070-922092 AGGGAGACCCCAGCACAGACGGG + Intergenic
985719302 5:1481038-1481060 AGGGAGAGGCCGGCACACGCAGG - Intronic
986292452 5:6411138-6411160 AGGGAGCCCACACCACCCGCGGG - Intergenic
986422528 5:7599131-7599153 AGGGACAGCCCAGGAGCAGCTGG + Intronic
986721897 5:10565520-10565542 AGGGAGAGCCCCAGAGCCGCGGG + Intronic
987211016 5:15683399-15683421 ACGGAGAGCACAGCCCCAGCAGG - Intronic
992174805 5:74139566-74139588 AGGGAGAGCTCAGCAGCCCGTGG - Intergenic
992657422 5:78923962-78923984 GGACAGAGCCCAGCACCCCCTGG - Intronic
995142262 5:108748329-108748351 AGGGATCGCCCAGCGCCCTCCGG + Intronic
997607503 5:135185639-135185661 AGGCAGAGCCCAGCAGCTGTGGG + Intronic
998104908 5:139462371-139462393 ATGGGGAGCCCAGCTCCCCCAGG + Intronic
1004334707 6:14754093-14754115 AGGGAGATCTCTGCACCCCCAGG - Intergenic
1004457395 6:15803779-15803801 AGGGAGGGCCCAGCAATCTCTGG - Intergenic
1005592947 6:27347963-27347985 ATTGAGAGCCCAGCCCCCGCTGG + Intergenic
1005841544 6:29747715-29747737 AGGGATGGTCCAGCACCCGTGGG + Intergenic
1006396891 6:33793442-33793464 GGGGGGAGCCCAGCACTGGCTGG - Intergenic
1006893694 6:37452055-37452077 AGGGACAGCACAACACCCACAGG - Intronic
1007819766 6:44552594-44552616 AGGAAGAGCCCAGCACAGGAGGG - Intergenic
1016777575 6:147921734-147921756 AGCCAGAGCCCAGCACCCCCTGG + Intergenic
1017919168 6:158856467-158856489 AGGCAGCGCCGAGCACCGGCTGG + Intergenic
1018035594 6:159878607-159878629 AGGGAGGGCCCACCTCCCCCGGG + Intergenic
1018953559 6:168393653-168393675 GGAGAGACCCCACCACCCGCGGG - Intergenic
1019305489 7:332585-332607 AGGGAGACCCCGGCGCCCGGTGG - Intergenic
1019529544 7:1496574-1496596 AGAGAGAGCCCAGGACCAGTTGG + Intronic
1020128299 7:5545459-5545481 CTGGAGAGCCCAGCACCTACAGG - Intronic
1021842547 7:24732628-24732650 AGGGAGAGCACAGCAACTGTGGG + Intronic
1022645271 7:32223797-32223819 ATGGAGACTCAAGCACCCGCAGG - Intronic
1023883474 7:44334856-44334878 AGGGAGCGTCCAGCAACCGAGGG - Intergenic
1026419660 7:70221002-70221024 AGGCAGAGCCCAGCAGTTGCAGG - Intronic
1029148747 7:98465371-98465393 AGAGAGAACCCAGCACGGGCCGG - Intergenic
1034578952 7:152026001-152026023 TGCGGGAGCCCAGGACCCGCGGG - Intronic
1034674712 7:152884121-152884143 ATGGAGTGCCCAGCACCCTGCGG - Intergenic
1034827683 7:154281379-154281401 AGGGAGAGCCCACCACATCCTGG - Intronic
1035021635 7:155804128-155804150 AGGGTGCGCCCGGCGCCCGCGGG - Intronic
1035677824 8:1467520-1467542 TGGCAGAGCCCAGCACAAGCTGG + Intergenic
1036814934 8:11895015-11895037 AAGGAGAGCACAGCAATCGCGGG - Intergenic
1037901472 8:22691832-22691854 AGCGAGAGCCCAGCGCGCTCCGG - Intronic
1037967505 8:23145776-23145798 AGGGAGAGGCAAGCATCCCCAGG + Exonic
1040092044 8:43408686-43408708 AGGGAGAGTCCAACACCAACAGG - Intergenic
1040385359 8:46911620-46911642 AGGGAGAGCCAAGCACTGACAGG + Intergenic
1041580013 8:59447673-59447695 AGGGAGAGCACAGCAACTGGGGG - Intergenic
1049220981 8:141428676-141428698 AGGGAGACCTGAGCACCTGCAGG - Intronic
1049251932 8:141593923-141593945 TGGGAGAGCCCAGTTCCCACAGG + Intergenic
1049425237 8:142535247-142535269 AGGCAGAGCCCAGGGCCAGCTGG + Intronic
1050121293 9:2310642-2310664 AGGAAGAGCCCAGGACCTGATGG - Intergenic
1052407784 9:28084320-28084342 TGTGAGAGCTCAGCACCTGCAGG - Intronic
1052970003 9:34371581-34371603 AGCGAGAGCGCAGCCGCCGCAGG + Exonic
1055378261 9:75675029-75675051 AAGAAAAGCCCAGCACCCGATGG - Intergenic
1056557238 9:87699954-87699976 AGGCAGAGCCCACCAACAGCAGG + Intronic
1056578078 9:87870877-87870899 AGGGAGAGCAGAGCAGCCGCAGG + Intergenic
1056581457 9:87890081-87890103 AGGGAGAGCTCTGCACCTGCAGG + Intergenic
1056617053 9:88177825-88177847 AGTGAGACCCCAGCCCCAGCCGG + Intergenic
1057114572 9:92508180-92508202 AGGGGGAGCCCAGCACCCGAGGG + Intronic
1057211743 9:93204383-93204405 AGGGAGGCCCAAGCACCTGCAGG + Intronic
1057547185 9:96027368-96027390 AGGGAGAGCCCAGGCCCCGCGGG + Intergenic
1057644316 9:96858874-96858896 AGGGAGAGCACAGCAGCTGTGGG + Intronic
1060328587 9:122643303-122643325 AGGGAGAGCACAGCAACTGAGGG + Intergenic
1060759581 9:126236010-126236032 AGGGTCAGCCCAGCCCTCGCTGG + Intergenic
1061187063 9:129060873-129060895 AGGGAAAGGCCAGCACGGGCTGG - Intronic
1061214954 9:129216384-129216406 AGGGTCTGCCCAGCATCCGCAGG - Intergenic
1061472232 9:130835570-130835592 AGGAAGGGCCCAGCAGCAGCGGG - Intronic
1061713874 9:132506464-132506486 AGGGAGGGCCCGGCAGCAGCTGG + Intronic
1061747832 9:132753240-132753262 TGAGAGAGCCCAGAACCAGCTGG - Intronic
1061862429 9:133474939-133474961 GGTGAGAGCCCAGCCCCGGCCGG - Exonic
1061872498 9:133528301-133528323 AGGGAGAGCCCACACCCCTCTGG - Intronic
1061935226 9:133853729-133853751 AGGGAGAGCCCAGGGCACTCAGG - Intronic
1062014019 9:134282329-134282351 AGGGTGAGGGCAGAACCCGCTGG - Intergenic
1062325402 9:136010318-136010340 ACGGGGAGCCCAGCACCGGGAGG + Exonic
1062539150 9:137034067-137034089 GGGGAGAGGCCAGCAGCCCCTGG - Intronic
1062541935 9:137045483-137045505 AGGGCCAGCCCCACACCCGCAGG + Intronic
1062631231 9:137464052-137464074 GGGGAGAGCTCAGCAGCCCCAGG - Intronic
1186634342 X:11386414-11386436 AGGGAGAGGCCAGCAGCTACAGG + Intronic
1186705758 X:12138273-12138295 AAGGAGAGCCGTGCAACCGCAGG - Intergenic
1187364088 X:18652133-18652155 AGAGAGTGCCCAGCACCTGTGGG - Intronic
1188709829 X:33381771-33381793 AGTGACAGCCCACCACCCTCAGG - Intergenic
1195073342 X:101302604-101302626 AGGAAAAGCCCAGAACCCGATGG - Intergenic
1196697987 X:118634568-118634590 AGAGGGAGGCCAGCACCCTCAGG + Intronic
1197168492 X:123405617-123405639 AGTGAGAGCTCAGCACCTTCAGG - Intronic
1199607055 X:149585938-149585960 AGGGAGGGCCCAGGTCCTGCTGG - Intronic
1199632067 X:149783430-149783452 AGGGAGGGCCCAGGTCCTGCTGG + Intronic
1199947419 X:152680225-152680247 AGGGAGGGCCCAGGCCCTGCTGG + Intergenic
1199962261 X:152788229-152788251 AGGGAGGGCCCAGGCCCTGCTGG - Intergenic
1200091835 X:153639650-153639672 AGGGAGGACCCAGCACTCGGAGG + Intergenic
1200116795 X:153773036-153773058 TGGGAGTGCCCACCACCCGACGG - Intronic
1200154877 X:153970132-153970154 AGGGAGAGCTGAGCAGGCGCAGG + Intronic
1200231529 X:154446182-154446204 GGGGAGAGCCAAGCACAGGCTGG - Intronic
1201711140 Y:16993759-16993781 AGGGAAAATCCAGCCCCCGCTGG + Intergenic