ID: 1180140925

View in Genome Browser
Species Human (GRCh38)
Location 21:45893014-45893036
Sequence ACAGGGAAGCCCCATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 328}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180140919_1180140925 0 Left 1180140919 21:45892991-45893013 CCTGGAGAGGGGAGCCGATAATA 0: 1
1: 0
2: 0
3: 3
4: 68
Right 1180140925 21:45893014-45893036 ACAGGGAAGCCCCATGAGGAGGG 0: 1
1: 0
2: 2
3: 35
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180140925 Original CRISPR ACAGGGAAGCCCCATGAGGA GGG Intronic
900566623 1:3335368-3335390 ACATGGAAGCCCTTGGAGGATGG + Intronic
901040094 1:6358491-6358513 AGAGGGAAGCCACAGGAGCAAGG + Intronic
901451136 1:9337675-9337697 CCAGGGAGTCCCCATCAGGAGGG - Intronic
901841448 1:11956556-11956578 TCAGAGAAGCCCCAAGAGAAAGG - Intronic
901948773 1:12724917-12724939 TCAGGGAAGCAACATGAGGCAGG + Intronic
902320771 1:15663830-15663852 ACATGGAAGGCCCTTTAGGAGGG - Exonic
903741707 1:25562299-25562321 TCAGGGAAGCCCAAAGGGGAAGG + Intronic
904064074 1:27734886-27734908 AGAGGGAAGCTCTATGTGGAAGG + Intronic
906202960 1:43971662-43971684 ACAGGGAAGACTCAGGATGAGGG + Exonic
907399325 1:54215041-54215063 ACAGGCAGGCCCCATGAAGCAGG - Intronic
907438463 1:54464081-54464103 TCAGAAAAACCCCATGAGGATGG + Intergenic
907792398 1:57679881-57679903 ACATGGTAACCCCATGAGGTTGG + Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
910776754 1:90884568-90884590 TCATAGAAGCCCTATGAGGATGG + Intergenic
911135469 1:94434825-94434847 ACTGGGAAGGGCCATGTGGAAGG - Intronic
914967981 1:152278061-152278083 ACAGGGAAGGACCATCAGGTTGG - Intergenic
915515569 1:156410497-156410519 ACCTGGAAGCCACTTGAGGAAGG - Intronic
917318997 1:173759272-173759294 ACAGGGAAGGACCATCAGGTGGG - Intronic
917972438 1:180217390-180217412 AAAGGGAAGACCCCTGAGGGAGG - Intergenic
918316961 1:183330505-183330527 ACAGGGAGGCTCCCTGGGGAGGG - Intronic
919274752 1:195399437-195399459 ACTGTGCAGCCTCATGAGGAAGG + Intergenic
919744464 1:200999978-201000000 ACAGGGAAGCTGGATTAGGAAGG + Intronic
919855517 1:201703756-201703778 ACAGGGCAGCCCCACGCGGATGG - Intronic
920252102 1:204628673-204628695 ACAGGGCAGCTCCGTTAGGAAGG - Intronic
921066182 1:211623627-211623649 AATGGAAAGCCCCATGAGGACGG + Intergenic
921261481 1:213388605-213388627 TCAGGGCAGCCCCATCTGGAGGG + Intergenic
924448852 1:244159633-244159655 ACAGGGCAGAGCCAGGAGGATGG - Intergenic
1063995246 10:11612149-11612171 CCAGGACAGCCCCATGAGGCAGG - Intergenic
1064061974 10:12145905-12145927 ACAGCTAAGCCCCAGGAAGAAGG + Intronic
1065515156 10:26517321-26517343 ACTGGGAAGGGCCAGGAGGAAGG - Intronic
1067099064 10:43321705-43321727 CCAGGGAGGCCCCCTGAGAAAGG + Intergenic
1067824837 10:49563316-49563338 ATAAAGAAGCCCCTTGAGGAGGG - Intergenic
1069921427 10:71818029-71818051 ACAGGGAAGCCCGGTGAGGAAGG + Intronic
1069924141 10:71836600-71836622 ACAGGGAAGCCAGAAGAGGATGG + Intronic
1072623342 10:97095414-97095436 CCTGGGAAGCCCCAAGAAGAGGG - Intronic
1073132112 10:101196296-101196318 GCAGGGAAGCCAGGTGAGGAAGG - Intergenic
1073642522 10:105267633-105267655 AGAGGGCAGCGGCATGAGGAAGG - Intergenic
1074951622 10:118342391-118342413 AAAGGGAAGCCCCAGGAGGCCGG - Intergenic
1075319226 10:121476698-121476720 GCAGAGAAGCTCCCTGAGGAGGG + Intergenic
1076701605 10:132275990-132276012 ACAGTGAAGGCCCGCGAGGATGG + Intronic
1076944607 10:133637651-133637673 ACAGGGAAGCGGCTGGAGGAAGG - Intergenic
1078086036 11:8233515-8233537 GCATGGATGCCCTATGAGGAAGG - Intronic
1079109994 11:17599950-17599972 GCAGGGCAGCCCCACCAGGAAGG + Intronic
1079299972 11:19269254-19269276 ACAGTGAAGCTCCCTGTGGATGG - Intergenic
1080576080 11:33600437-33600459 ACAGTGAAGCCATATGGGGAAGG + Intronic
1080594941 11:33764336-33764358 AGAGGGAAGGACTATGAGGAGGG + Intronic
1080824686 11:35837845-35837867 ACAGGGAGGCCCCAAGAGCAGGG - Intergenic
1082140476 11:48603162-48603184 ACAGGGAAGAACCATGAGTTGGG + Intergenic
1082230016 11:49752237-49752259 ACAGGGAAGCCCCAAGGAGCAGG - Intergenic
1083811808 11:65110614-65110636 TCAGGGGAGCCCCAGGGGGAAGG + Intronic
1084043921 11:66558184-66558206 ACAGTCCAGCCCCATGAGGTAGG - Intronic
1084270791 11:68028078-68028100 AGAGGGAAGACCCAGGAGGGAGG - Exonic
1084367696 11:68713417-68713439 AATGGGAAGCTCCATCAGGATGG + Intronic
1085038249 11:73312287-73312309 ACAGGAAAGCCACACGAAGAAGG - Intronic
1085048791 11:73368756-73368778 CAAGGGAAGCCCCTTCAGGAAGG + Exonic
1085273734 11:75285180-75285202 TCACGGGAGCCCCATGAGGGAGG - Intronic
1085325008 11:75599852-75599874 AAAGGGAAGCTCAAAGAGGAGGG - Intronic
1086620043 11:88876712-88876734 ACAGGGAAGCCCCAAGGAGCAGG + Intronic
1087114811 11:94513544-94513566 ACCGGGAGGCCCCAGGAGGGAGG + Intergenic
1089492571 11:118893104-118893126 AACAGGAAGACCCATGAGGAGGG + Intronic
1089551329 11:119281195-119281217 GCAATGAAGTCCCATGAGGATGG - Intronic
1089831028 11:121328447-121328469 TCAGGGATGCCTCATGGGGACGG + Intergenic
1090420075 11:126568565-126568587 ACAGGGAGGCCACATGGGGCAGG + Intronic
1090884172 11:130861623-130861645 ACACGGAAGCCCCCAGAAGAAGG - Intergenic
1091270815 11:134310683-134310705 ACAGAGACTCCACATGAGGAGGG - Intronic
1091803659 12:3341396-3341418 AGAGGGAGGCCCCATCAGGCAGG + Intergenic
1091972953 12:4803590-4803612 ACAGGGGAAGCCCAGGAGGAGGG + Intronic
1092998054 12:13969215-13969237 ACAGCAAAGCCCCAAGAGAAGGG + Intronic
1093397588 12:18702564-18702586 AGAGGGAAGACCCAAGATGATGG - Intronic
1093666206 12:21816393-21816415 ACATGGAGGCCCCATGATGAAGG + Intronic
1095870360 12:47020101-47020123 TCATGGAAGCCACATGTGGAAGG - Intergenic
1096507632 12:52105164-52105186 ACAAGGAACCCCCAAAAGGAAGG - Intergenic
1097999330 12:65923417-65923439 ACAGGGAAGCCCCTAGTGGGTGG - Intronic
1102515268 12:113441948-113441970 ACAGGGCAGGGACATGAGGAGGG + Intergenic
1102931336 12:116864627-116864649 ACAGGGAAGCGTGATGAGCAGGG + Intronic
1103224906 12:119278526-119278548 ACAGTGCAGCTCCATGAGGCAGG - Intergenic
1103890205 12:124232652-124232674 GCAGGGCAGCCCTAGGAGGACGG - Intronic
1103912536 12:124360272-124360294 ACTGGGATGCCCCATGACCAGGG - Intronic
1104766340 12:131332811-131332833 GCAGGGAGGCCCCATGAGTCGGG + Intergenic
1104806150 12:131590745-131590767 ACAGGGAGGACCCTGGAGGAGGG + Intergenic
1104813067 12:131629786-131629808 GCAGGGAGGCCCCATGAGTCGGG - Intergenic
1105013457 12:132771585-132771607 ACAGGCAGGCACCGTGAGGAAGG - Exonic
1106634944 13:31518612-31518634 GCTGGGAAGCTACATGAGGAAGG + Intergenic
1107113684 13:36724328-36724350 ACAGGGAAGATCCATGAGAGGGG - Intergenic
1107842447 13:44472965-44472987 CCAGGGAAGCCCAATTATGACGG + Intronic
1108020961 13:46127222-46127244 AAAGGGAAGCCACATGAAGCTGG + Exonic
1108469776 13:50756317-50756339 ATAGGGAAGGCCCATCAGGTAGG + Intronic
1109223397 13:59663899-59663921 ACCGGGAAGGCCGATGAGAAAGG + Intergenic
1111242267 13:85490606-85490628 CCAGGAAAGCCCAATGAGGCTGG + Intergenic
1113733265 13:112657586-112657608 GGAAGGAAGTCCCATGAGGAAGG - Intronic
1113733317 13:112657739-112657761 GGAAGGAAGTCCCATGAGGAAGG - Intronic
1113762311 13:112858039-112858061 ACCGGGAAGGCTCATGATGATGG + Intronic
1114752144 14:25216980-25217002 TCACAAAAGCCCCATGAGGAAGG + Intergenic
1115314849 14:32014854-32014876 ACAGGGAAGCTGCAGGAAGAAGG - Intronic
1115835481 14:37397595-37397617 ATAGGGAAGGCCCATCAGGTGGG + Intronic
1116257738 14:42578641-42578663 ACAGGGAAACAACATGAGCAGGG - Intergenic
1116951853 14:50885780-50885802 ACAGGTAAGCCCACAGAGGAGGG + Exonic
1117494168 14:56285364-56285386 ATAGGGAAGCCCCAGGGTGAAGG + Intronic
1117875275 14:60245657-60245679 ACTGGGCAGCCCCATTAGGGAGG - Intergenic
1118772575 14:68952039-68952061 AAAGGGAAGCCACATGAAGCTGG + Intronic
1119164474 14:72480779-72480801 CCAGGGAAGCCAGATCAGGATGG - Intronic
1119619166 14:76118643-76118665 TGAGGGAAGCTCCATGAAGAAGG + Intergenic
1120161209 14:81146893-81146915 ACAGGGCAGCACCATGAGAGTGG + Intergenic
1121009468 14:90511558-90511580 TCAGGGAAGGCCAAGGAGGAAGG + Intergenic
1121267783 14:92615560-92615582 ACAGGGAAGCCCCAGAGGGAGGG + Intronic
1121310040 14:92930862-92930884 ACAGAGAAGCCCCACATGGAGGG + Intronic
1121432135 14:93895115-93895137 AGGAGGCAGCCCCATGAGGAGGG - Intergenic
1121643273 14:95500553-95500575 ACAGGCCAGCTCCAGGAGGAAGG - Intergenic
1122321929 14:100860596-100860618 ACAGGCAGGCCCCAGGAGGGAGG - Intergenic
1123682733 15:22774217-22774239 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1123762703 15:23444987-23445009 AAACGGAAGCCCAAAGAGGAGGG + Intronic
1124334484 15:28846740-28846762 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
1124557146 15:30736495-30736517 ATAGGGAAGGCCCATCAGGTGGG - Intronic
1124674118 15:31669252-31669274 ATAGGGAAGGCCCATCAGGTGGG + Intronic
1127627616 15:60795712-60795734 ATAGGGAGGCGCCATAAGGAAGG - Intronic
1127812005 15:62572967-62572989 ACTGGGAAGGCCCGTGAGCAGGG - Intronic
1128387003 15:67156822-67156844 AGAGGGAAGTCCCATGATGATGG + Intronic
1128998927 15:72317394-72317416 ACAGGGCTGCCCCATTAAGATGG + Intronic
1129004045 15:72357496-72357518 ACAGGGAAGAACCAGCAGGAGGG - Intronic
1130706536 15:86238064-86238086 TCAGGGAAGACCCTTGAGGAGGG - Intronic
1131757102 15:95576779-95576801 ACAGAGAAGCATCATGAGCAAGG - Intergenic
1132950579 16:2560065-2560087 GCCGGGAGGCCCCCTGAGGACGG + Intronic
1132963770 16:2640105-2640127 GCCGGGAGGCCCCCTGAGGACGG - Intergenic
1133899856 16:9963848-9963870 AAATGCAAGCCCCATGAGGCAGG - Intronic
1134052053 16:11144250-11144272 GCAGGGACGCCCCAAGAGGATGG - Intronic
1134890558 16:17838019-17838041 CCAGGGCAGCCCCATGAGGTTGG - Intergenic
1135564112 16:23498602-23498624 ACATGACAGTCCCATGAGGAAGG - Intronic
1136116956 16:28100763-28100785 ACAGGTGAGCCCCATGGGGAAGG + Intronic
1136999596 16:35217166-35217188 AATGGGAGGGCCCATGAGGAAGG - Intergenic
1137053995 16:35734833-35734855 ACAGGAAGGCCCCAGGCGGAGGG - Intergenic
1139157304 16:64459053-64459075 GGAGGGAAGCCACATGTGGATGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1140143918 16:72286923-72286945 AGAAGGAAGGGCCATGAGGAAGG - Intergenic
1140985908 16:80157772-80157794 AGAGAGAAGCCACGTGAGGAGGG - Intergenic
1141344776 16:83234475-83234497 AGAGGGAAACCCCTTGAGGTTGG + Intronic
1141589977 16:85061910-85061932 ACCGGGAAGGCCAATGAGGCCGG - Intronic
1142135284 16:88449182-88449204 ACAGGGAGGCTCCAGGATGAAGG + Intergenic
1142282679 16:89156755-89156777 CCAGGGAAGCCGCAGGTGGAGGG - Intergenic
1144679636 17:17184369-17184391 CCAGGGAATCCCCAGCAGGATGG - Intronic
1145974409 17:28976020-28976042 CCAGAGAAGCCCCTTCAGGATGG - Intronic
1146477372 17:33173768-33173790 TCATGGCAGTCCCATGAGGAAGG - Intronic
1146599971 17:34205670-34205692 GTAGGGAAGGCCCAGGAGGAAGG - Intergenic
1147830778 17:43297153-43297175 TCAGGGAAGCCGCACGTGGAGGG + Intergenic
1148871994 17:50663715-50663737 ACCAGGAAGCCCCACCAGGAGGG - Exonic
1150295167 17:64003514-64003536 AGAGGGAAGCCTCAGGATGAAGG + Intronic
1151178944 17:72311963-72311985 CCAGGGAGCCCCCATGAGGAGGG + Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1152585830 17:81189055-81189077 ACAGGGCCCACCCATGAGGATGG - Intergenic
1155231727 18:23780709-23780731 ACAGGAAAGCATCTTGAGGAAGG + Intronic
1157410308 18:47457804-47457826 GCAGGGCAGGCCCAGGAGGAAGG - Intergenic
1157431551 18:47631997-47632019 ACAGGGAATCCCCGTGTTGAGGG + Intergenic
1157616024 18:48988256-48988278 ACAAGGAAGCCACATGGGGAGGG - Intergenic
1158014451 18:52766989-52767011 AGAGAGAATCCCCATGAAGAAGG + Intronic
1160257653 18:77260590-77260612 ACAGGAAAGCCCCGTATGGACGG - Intronic
1161112848 19:2479410-2479432 ACAGGGAAACCCCGGGAGGGGGG + Intergenic
1161776058 19:6262779-6262801 ACAGGGGAGCCCCAGGTGGCTGG + Intronic
1162317327 19:9947512-9947534 ACAGGGAAGCCTCAGAAGAATGG + Intergenic
1162717879 19:12645235-12645257 ACAGGGAAGCCCAGGGAGGGTGG - Intronic
1163175823 19:15563597-15563619 ACAAAGAAGCCCCAGGAGGAGGG + Intergenic
1163608695 19:18290234-18290256 GCAGGGAAGCCCCAAGCAGAAGG + Intergenic
1163638760 19:18450117-18450139 GCAGGGAAGCCCCAGGAGCCAGG - Intronic
1163691777 19:18742319-18742341 GCTGGGAAGGACCATGAGGAAGG + Intronic
1165386654 19:35514008-35514030 ACAGGGAAGCCCCAGGGGACAGG + Intergenic
1165890960 19:39111989-39112011 GCAGGGAAGGCCTCTGAGGAGGG - Intergenic
1165912399 19:39237309-39237331 ACAGGTTAGCCCCAGCAGGAGGG + Intergenic
1165913582 19:39244510-39244532 ACAGGTTAGCCCCAGCAGGAGGG + Intronic
1165917382 19:39269114-39269136 ACAGGTTAGCCCCAGCAGGAGGG - Intronic
1166061741 19:40329970-40329992 ACAGGCAAGCCCCATTTGGGTGG + Intronic
1167740883 19:51324365-51324387 AAAGGGAAGTCTCATGAGGCTGG + Intronic
1168519537 19:57037480-57037502 GGTGGGGAGCCCCATGAGGAGGG - Intergenic
925343325 2:3151547-3151569 ATAGGGAAGGCCCATCAGGTGGG - Intergenic
926121489 2:10243468-10243490 AGAGGGAGGCCACATCAGGAGGG + Intergenic
926630446 2:15130780-15130802 AGAGGGTGGCCCCCTGAGGATGG - Intergenic
926703214 2:15818082-15818104 AGACGGGAGCCCCAGGAGGAGGG + Intergenic
927468411 2:23354007-23354029 TCAGGGAAGCCCCAGGAAGGAGG + Intergenic
928201683 2:29251312-29251334 CCAGGGAGGCCCCTGGAGGAGGG - Intronic
929142183 2:38676261-38676283 ACAGGGGAGCCCCAAGAGAAAGG + Intronic
929536252 2:42786220-42786242 ACAGGGAAGACCTCTGAGCAGGG - Intronic
929662331 2:43799367-43799389 TCAGAGAAGAGCCATGAGGATGG + Intronic
930023368 2:47014722-47014744 CCAGCCAAGCCCCATGAGCAGGG + Intronic
934989795 2:98913298-98913320 AGAGGGAAGCCACATGAGAACGG + Intronic
936141252 2:109943612-109943634 ACTGGGAAGCCACATGTAGAAGG + Intergenic
936177940 2:110241561-110241583 ACTGGGAAGCCACATGTAGAAGG + Intergenic
936203441 2:110427870-110427892 ACTGGGAAGCCACATGTAGAAGG - Intronic
936381698 2:111992294-111992316 CCATGAAAGGCCCATGAGGATGG + Intronic
937776212 2:125779024-125779046 ACAGAGAAGACCTATGAGGTAGG + Intergenic
937849614 2:126620882-126620904 ACAGGACAGCCCCATAATGAGGG - Intergenic
941315571 2:163987949-163987971 ACAGTGAGGCCCCATGAATATGG + Intergenic
942446610 2:176082522-176082544 TCGGGGAAGCCCCGTCAGGAAGG + Intronic
944516048 2:200512730-200512752 ACAAGGAAGAGCCAAGAGGAAGG + Intronic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
946348075 2:219127291-219127313 ACTGGAGAGTCCCATGAGGAAGG - Intronic
946779188 2:223175587-223175609 TCAGGGAAAGGCCATGAGGATGG - Intronic
947843900 2:233228362-233228384 CCTTGGAAGACCCATGAGGATGG + Intronic
947917806 2:233845518-233845540 CCAGGGCAGCGCCATCAGGAAGG - Intronic
948272737 2:236686871-236686893 GCATGGAAGCCCCATCTGGAGGG - Intergenic
948610224 2:239162077-239162099 ACAGGGCAGCCCCCAGAGGGTGG - Intronic
1168972530 20:1940389-1940411 AAAGTGAGGCCCCAGGAGGAGGG - Intronic
1169244080 20:4011452-4011474 AAAGGGAAGTCCCAGGATGATGG + Intronic
1171418293 20:24998684-24998706 ACAGGGCAGACCTATGAAGAAGG - Intergenic
1172331698 20:34080092-34080114 ACAGGGAGGGCTCATGGGGAAGG - Exonic
1173182323 20:40814639-40814661 ACACTGCAGCCCCATGAGGCTGG - Intergenic
1174299375 20:49570368-49570390 TCAAAGCAGCCCCATGAGGAAGG - Intergenic
1174553371 20:51377389-51377411 AGAGGGAAGGCCCATGAGGAAGG + Intergenic
1175069082 20:56316587-56316609 ACAGGGAAGGACCATCAGGTGGG - Intergenic
1175127458 20:56763176-56763198 ACAGGGAAGACTCATGGGGTTGG - Intergenic
1175548728 20:59801613-59801635 ACAAATAAGCCACATGAGGAAGG - Intronic
1176367721 21:6043991-6044013 CCAGGGAAGGCCCATGAAGGTGG - Intergenic
1176369111 21:6051982-6052004 ACGTGGAAGCCCCAGGAGGCAGG + Intergenic
1178629194 21:34244407-34244429 ACTGGGATGCCCCAGGAGGCAGG - Intergenic
1179754408 21:43486559-43486581 ACGTGGAAGCCCCAGGAGGCAGG - Intergenic
1179755798 21:43494551-43494573 CCAGGGAAGGCCCATGAAGGTGG + Intergenic
1179805493 21:43834593-43834615 ACATGGAAGCCGCAACAGGAAGG - Intergenic
1179875062 21:44262992-44263014 ACAGGGAAGGCCCTGGAGGATGG + Intergenic
1180061736 21:45388746-45388768 ACAGGGAGGCCCCAGCAGGAAGG + Intergenic
1180140925 21:45893014-45893036 ACAGGGAAGCCCCATGAGGAGGG + Intronic
1180955810 22:19740726-19740748 CGAGGGAAGCCCCATGATGCGGG + Intergenic
1183276949 22:36904476-36904498 ACATGGCAGCCCTGTGAGGAAGG + Intergenic
1183338884 22:37267154-37267176 ACAGGGGAGCCCCAGGCGGTGGG + Intergenic
1184458501 22:44624597-44624619 AGAGGGAGGCCACGTGAGGATGG + Intergenic
1185154261 22:49183725-49183747 ACAGGGGGGCCCCATGGGGGAGG + Intergenic
1185247539 22:49781138-49781160 ACTGGGAAGGCCCTTGAGGGTGG - Intronic
1185415010 22:50705060-50705082 ACAAGGAAGCCAGAAGAGGACGG + Intergenic
949300854 3:2582418-2582440 ACAGGGAAGCTCCATAACGGAGG - Intronic
949306583 3:2648616-2648638 AAAGGGAGGCCCCAGGAGAAGGG - Intronic
950365445 3:12480297-12480319 ACAGGGCAGGCCCATGTGCAAGG - Intergenic
950687276 3:14627592-14627614 ACTGGGAAGCCTTCTGAGGAAGG - Intergenic
950723145 3:14898867-14898889 GCAGGGAAGGCCCCTGAGGAGGG + Intronic
952255958 3:31695963-31695985 ACAGAGCGGCCCTATGAGGAAGG + Intronic
952337826 3:32420413-32420435 AAAGTGAAGCCCAATGAGGTGGG + Intronic
953202991 3:40794479-40794501 ACAGGGAGGCTCCATGGGGATGG + Intergenic
953406595 3:42662920-42662942 ACAGGGCTGCCCCAGGAGGCAGG + Intronic
955111521 3:55955384-55955406 AGAGGGAAGGGCCATGAGGCAGG - Intronic
955403318 3:58609088-58609110 ACAAGGAGGCCCCATGATGCAGG + Intronic
956745165 3:72305435-72305457 GCGTGGAAGCTCCATGAGGATGG - Intergenic
956789368 3:72668762-72668784 ACAGGAAAGGCACCTGAGGAGGG - Intergenic
957021818 3:75136656-75136678 ACAGGGATGCTCCATGGGGCAGG - Intergenic
957042948 3:75350904-75350926 ACAAGGAATCCCCAAAAGGAAGG + Intergenic
958882772 3:99691645-99691667 AGAATGAAGCCCCATGAGGGTGG - Intronic
958969929 3:100600570-100600592 GCAGGGAAGGCCCATCAGGTTGG + Intergenic
959495960 3:107052162-107052184 AAATCCAAGCCCCATGAGGATGG + Intergenic
960049612 3:113227406-113227428 ATAGGGAAGCCCCAGAAAGATGG + Intronic
960104290 3:113777424-113777446 ACAGAGAAGCCTCATGGAGAAGG + Intronic
960267200 3:115633712-115633734 AGAGGTAAGCCTCAGGAGGATGG - Intronic
961046791 3:123714239-123714261 GCTGCGATGCCCCATGAGGAGGG + Intronic
962041297 3:131710007-131710029 ATAGGTAAGCTCCATGAGGCAGG + Intronic
962775837 3:138658962-138658984 AAAGGGAAGGCCCAGGATGATGG - Intronic
963082737 3:141409623-141409645 ATAGGGAGGCTCCATGAGGGTGG - Intronic
963383958 3:144567441-144567463 ACTGGGAAGCCACATGTAGAAGG + Intergenic
964917469 3:161854427-161854449 ATAGGGAAGGCCCATCAGGTGGG + Intergenic
966829762 3:183997513-183997535 ACAGGGAAGACATAGGAGGAAGG - Intronic
968554158 4:1238838-1238860 CCAGGGCAGCTCCATGAGGCAGG + Intronic
969280013 4:6163622-6163644 ACAATGAAGCTTCATGAGGAAGG + Intronic
970038046 4:11762095-11762117 ACAGGGAAGACTTATGAGAAAGG + Intergenic
972732344 4:41807304-41807326 ACAGGGAGGACCCATGTGGTTGG + Intergenic
973730956 4:53821833-53821855 ACAGGGATGCACCCTGGGGAAGG + Intronic
975033987 4:69658587-69658609 ATAGGGAAGGCCCATCAGGTGGG - Intergenic
975066505 4:70072328-70072350 AAATGTAAGCCCCATGAGGGAGG - Intergenic
976740311 4:88349557-88349579 ACATGGAAGCCCCCTGGGGTGGG - Intergenic
977000384 4:91491224-91491246 ACATGTAAGCACCATGTGGAAGG - Intronic
977682909 4:99815077-99815099 ACAGGACAGCAACATGAGGAAGG + Intergenic
977746789 4:100558774-100558796 ACAGGGAAGGACCATAAGGTGGG - Intronic
978332144 4:107625400-107625422 ACAGGGATGCAACATGAGGGAGG + Intronic
979374368 4:119928143-119928165 ACAGGGAAGCCTGATGAGAGAGG - Intergenic
980173164 4:129313486-129313508 AGAGAGAAGCCCAATTAGGAGGG - Intergenic
980969443 4:139555725-139555747 GCAGGGCAGCCCCTTGAGGCCGG - Intronic
981199701 4:141966191-141966213 ACAGGGAAGCTCAAAGTGGATGG + Intergenic
982619018 4:157679459-157679481 GCTGGGAAGCCTCATGAGCATGG + Intergenic
985405897 4:189637997-189638019 ACAGGGAAGCCAAATGAGAGTGG - Intergenic
985447993 4:190038161-190038183 ACAGGGAAGCGGCTGGAGGAAGG - Intergenic
985903452 5:2814625-2814647 ACAGGGAAGCTGCCTGAGGATGG - Intergenic
985903698 5:2816591-2816613 CCAGGGAAGCCCCCTCAGGATGG - Intergenic
986393339 5:7304753-7304775 AAACGGAAGCCCAAAGAGGAGGG + Intergenic
987186533 5:15426181-15426203 ACAGGAAAGCCTCATCTGGAGGG + Intergenic
988738620 5:34047417-34047439 ACAGTGAAGCACCATGGGGGAGG - Intronic
989273571 5:39560059-39560081 GCAAGGAAGCCCCGTGAGGCTGG - Intergenic
990628735 5:57643392-57643414 AGAGGAAAGACCCATGAGAAAGG + Intergenic
991044422 5:62208286-62208308 TCAGGGAAGGCCTTTGAGGAAGG - Intergenic
995219019 5:109627280-109627302 ACAGTGAAGCCTCAAGAAGAGGG + Intergenic
995281701 5:110342865-110342887 CCATGGGAGCCCCATGAGTAGGG - Intronic
995536490 5:113141619-113141641 GCAGGGAATCCCCTCGAGGAGGG + Intronic
998096763 5:139400192-139400214 ACATGGGAGCCCCATCAGTAAGG + Intronic
998769369 5:145524401-145524423 ACAGAGAGGCCTCAAGAGGATGG + Intronic
999367924 5:151034937-151034959 TCAGGCTAGCTCCATGAGGAAGG + Intronic
1000917356 5:167098662-167098684 AAAAGGAAGCCCCTTAAGGAGGG + Intergenic
1002042948 5:176527874-176527896 CCAAGGAAGTCCCAGGAGGATGG - Exonic
1002357497 5:178642590-178642612 TCAGGAAAGCCCCCTGAGGTTGG + Intergenic
1002434318 5:179221660-179221682 GCAGGGAAACCCCATGTGGGCGG + Intronic
1002521899 5:179796778-179796800 CGAGGGAAGGCCCCTGAGGAGGG - Intergenic
1003259291 6:4502317-4502339 ACATGGATGAGCCATGAGGATGG - Intergenic
1003333901 6:5152756-5152778 ACAGAGGAGGCCCAAGAGGAAGG - Intronic
1003581963 6:7347959-7347981 ATAGGGAAGGCCCATCAGGTAGG - Intronic
1003966470 6:11256875-11256897 TCAGAGCAGCCCCATGTGGATGG + Intronic
1004024338 6:11804661-11804683 ACATGGAAGCCCCAGAAGGAAGG - Intronic
1006152945 6:31998978-31999000 ACAGGGAAGCATTGTGAGGAGGG - Intronic
1006159253 6:32031715-32031737 ACAGGGAAGCATTGTGAGGAGGG - Intronic
1007075702 6:39064904-39064926 ACAGGGGAGCTCCCTGAGGACGG + Intronic
1007664378 6:43505765-43505787 CCAGCGCAGCCCCAAGAGGATGG + Exonic
1010285877 6:74077297-74077319 AGAGGGCAGCACCAAGAGGATGG - Intergenic
1011620402 6:89237339-89237361 GGAGGGAAGGCCCATCAGGAAGG + Intergenic
1011813055 6:91155228-91155250 ACTGGGAAGCCCCAGGATGATGG - Intergenic
1012510994 6:100001665-100001687 ACGGGGAAGCATCATGAGCATGG - Intergenic
1012996796 6:105982648-105982670 CCATGCAAGCTCCATGAGGATGG - Intergenic
1017822832 6:158061348-158061370 CCAGGGAAGCCTCATATGGAAGG + Intronic
1018986155 6:168638606-168638628 GCTGGGAAGGCCCATCAGGAGGG + Intronic
1019346399 7:532934-532956 ACAGGGAAGTCCCCTCAGGCAGG - Intergenic
1019546518 7:1579626-1579648 ACTGGGAAGCCGCGTCAGGAGGG + Intergenic
1019814414 7:3189230-3189252 CCACTGCAGCCCCATGAGGAGGG + Intergenic
1021100453 7:16583316-16583338 AGACAGATGCCCCATGAGGATGG - Intergenic
1021315736 7:19145200-19145222 AGAGGGAAGACCCAGGAGGATGG - Exonic
1023157468 7:37265538-37265560 ACAGGGACGCCTCATGAGAGCGG - Intronic
1023534181 7:41190825-41190847 AAAGGGAAGTCACATCAGGAAGG - Intergenic
1023614862 7:42009664-42009686 AATGGGAAGCCCCAGGAGAACGG + Intronic
1024039698 7:45542570-45542592 ACAGGGGAGACCCATCAGGAGGG + Intergenic
1024669278 7:51577422-51577444 ATAGGGAAGGCCCATCAGGTGGG + Intergenic
1024917215 7:54515165-54515187 ATAGGGAAGCACCATCAGGTGGG + Intergenic
1025708871 7:63890212-63890234 TCAGGGAGGCCCTGTGAGGATGG + Intergenic
1025708883 7:63890273-63890295 TCAGGGAGGCCCTGTGAGGATGG + Intergenic
1026509940 7:71019389-71019411 GCTGGGCAGCCCCAGGAGGAGGG - Intergenic
1026979729 7:74519291-74519313 ACATAACAGCCCCATGAGGAGGG - Intronic
1029049884 7:97674697-97674719 ACAGGGAAGCCCAAGGAGAATGG - Intergenic
1029527181 7:101102072-101102094 GAATGCAAGCCCCATGAGGACGG + Intergenic
1029598144 7:101548599-101548621 ATAGGGAGGCTCCAGGAGGAAGG + Intronic
1029730423 7:102434554-102434576 AGAGGGATGCCCCATCAGTAAGG - Intronic
1029735177 7:102461758-102461780 CCAGGACAGCCCCAAGAGGAAGG + Intronic
1033213278 7:139476286-139476308 ACAGGGAATCCCACGGAGGAGGG + Intronic
1034699511 7:153084032-153084054 AGAGGGCAGCCCCAAGGGGATGG + Intergenic
1035042974 7:155944355-155944377 ACACGTAAGCTCCATGAGGGAGG - Intergenic
1035254727 7:157619020-157619042 ACAGGGTGGCCACATGTGGATGG - Intronic
1038385541 8:27140931-27140953 AAATTGAAGCCCCATGTGGAGGG + Intergenic
1038493939 8:27988831-27988853 AGATAAAAGCCCCATGAGGATGG + Intronic
1038885952 8:31663357-31663379 GCAGGGAAGCCCAAAGAGTAGGG + Intronic
1041361988 8:57064463-57064485 CCAGGGAAGCCCCTGGAGCAGGG + Intergenic
1041497822 8:58506671-58506693 ACAGGGTAGCACCATGAAGCAGG + Intergenic
1041717253 8:60943496-60943518 AGAGGGAAGCCCCATGACAAAGG - Intergenic
1042889019 8:73586409-73586431 ACAGGAAACCCCTATTAGGAAGG - Intronic
1045686799 8:104720929-104720951 GCAGGGAAGGCCTATGAGGCAGG - Intronic
1049127695 8:140807008-140807030 GAAGGAAAGCCCCATGAGGATGG + Intronic
1049372734 8:142275447-142275469 CCAGGGAAGCCACATCAGCAGGG + Intronic
1050026967 9:1345168-1345190 ACAGGAAAGCTCCATGATGTTGG - Intergenic
1050112496 9:2231415-2231437 AAAGAGAAGTCCCATCAGGAAGG - Intergenic
1051925662 9:22321912-22321934 ATAGAGAAGGCCCATCAGGAAGG - Intergenic
1053282304 9:36828567-36828589 ATAGGGAAGGCCCCTGAAGAGGG - Intergenic
1057139020 9:92715692-92715714 GCAGGGCAGCCCTATGAGGCTGG + Intronic
1057203241 9:93154835-93154857 ACCAGGAAGGCCCATGTGGAAGG - Intergenic
1057221827 9:93261672-93261694 ACAGGGACTCCCCTTGGGGAGGG + Intronic
1057997678 9:99834241-99834263 ACAGAGAAGAACCATGAGAAAGG + Intronic
1059527580 9:115006814-115006836 ACAGGGAAGCCACAAGATGCAGG - Intergenic
1059688248 9:116658483-116658505 ACAGTGAATCTCCATGAGGTAGG + Intronic
1060590541 9:124813612-124813634 ACAGAGAAGCCCCAAGAAGGAGG + Exonic
1061012546 9:127964041-127964063 ACAGGGAAGACCCAGAAGGAGGG + Intronic
1061297926 9:129687021-129687043 GCAGGGAAGCCCCCTGCAGAGGG + Intronic
1062544452 9:137055248-137055270 AAAGGGCAGCCCCATGGGGCAGG + Intergenic
1186477125 X:9866137-9866159 ACAGGGAAGCCCCTAGAAGATGG - Intronic
1186969147 X:14821373-14821395 AAAGTGAAGCCCCATGCTGAGGG + Intergenic
1187344091 X:18447192-18447214 ACAGGACAGCCCCATGACAAAGG + Intronic
1189049096 X:37625279-37625301 ACAGAGATGCCCCATGAGTGAGG - Intronic
1191251098 X:58260548-58260570 GCAAGGAAGCCCCAGGGGGAAGG + Intergenic
1191251359 X:58261639-58261661 GCAAGGAAGCCCCCAGAGGAAGG + Intergenic
1192150978 X:68712232-68712254 ACTGGGAAGCTCCCTGAGGAGGG + Intronic
1193113565 X:77754706-77754728 AAAGGGAAGCTCCCAGAGGAAGG - Intronic
1195415757 X:104618333-104618355 ACAGGGAAGCCCAATGGGTGGGG + Intronic
1197665383 X:129217554-129217576 ACAGGGAAGTCACTTCAGGAAGG - Intergenic
1199922397 X:152421597-152421619 AAAGGCAAGCCCCATGGGGTGGG + Intronic
1200150740 X:153950191-153950213 ACAGGGAAGGCCCAGGAAGCCGG - Intronic
1201306711 Y:12556710-12556732 ATAGGGAAGGACCATGAGGTGGG - Intergenic