ID: 1180141482

View in Genome Browser
Species Human (GRCh38)
Location 21:45896031-45896053
Sequence CAGGGTGCACGGGAGTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 201}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180141482_1180141498 16 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141498 21:45896070-45896092 CCTGGTCAGCACATGGTGGGTGG 0: 1
1: 0
2: 2
3: 28
4: 233
1180141482_1180141488 -7 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141488 21:45896047-45896069 CACCCTGTGCCCAGCAGGCGAGG 0: 1
1: 0
2: 1
3: 27
4: 266
1180141482_1180141491 -2 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141491 21:45896052-45896074 TGTGCCCAGCAGGCGAGGCCTGG 0: 1
1: 0
2: 4
3: 32
4: 264
1180141482_1180141499 17 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141499 21:45896071-45896093 CTGGTCAGCACATGGTGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 168
1180141482_1180141496 13 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141496 21:45896067-45896089 AGGCCTGGTCAGCACATGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 193
1180141482_1180141494 9 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141494 21:45896063-45896085 GGCGAGGCCTGGTCAGCACATGG 0: 1
1: 0
2: 3
3: 19
4: 196
1180141482_1180141495 12 Left 1180141482 21:45896031-45896053 CCCCTGAACTCCCGTGCACCCTG 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1180141495 21:45896066-45896088 GAGGCCTGGTCAGCACATGGTGG 0: 1
1: 0
2: 1
3: 20
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180141482 Original CRISPR CAGGGTGCACGGGAGTTCAG GGG (reversed) Intronic