ID: 1180142936

View in Genome Browser
Species Human (GRCh38)
Location 21:45903276-45903298
Sequence CGTGGCCAGTTGCCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180142928_1180142936 10 Left 1180142928 21:45903243-45903265 CCTGTTTTAGTTTCTCCCTCGTG 0: 1
1: 0
2: 0
3: 12
4: 126
Right 1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 398
1180142934_1180142936 -6 Left 1180142934 21:45903259-45903281 CCTCGTGGCCAGGGTTTCGTGGC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 398
1180142932_1180142936 -5 Left 1180142932 21:45903258-45903280 CCCTCGTGGCCAGGGTTTCGTGG 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 398
1180142926_1180142936 29 Left 1180142926 21:45903224-45903246 CCTCCAGCTTCAGTTGGGACCTG 0: 1
1: 0
2: 28
3: 12
4: 182
Right 1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 398
1180142927_1180142936 26 Left 1180142927 21:45903227-45903249 CCAGCTTCAGTTGGGACCTGTTT 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG 0: 1
1: 0
2: 0
3: 16
4: 398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180142936 Original CRISPR CGTGGCCAGTTGCCCCATGC AGG Intronic
900547413 1:3236540-3236562 CGTGGCCATGGGCCCCACGCCGG + Intronic
901771882 1:11534712-11534734 CGTGGCCAGATGCCCCCGACAGG - Intronic
902787849 1:18744899-18744921 CCTGGCCAGTTTCCACAGGCAGG - Intronic
903081420 1:20815748-20815770 CCCGGCCAGTTGCCCCGTCCAGG + Intronic
903148214 1:21388227-21388249 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
903605407 1:24572017-24572039 CGTGGCCAGGGGCACCACGCTGG + Intronic
903637759 1:24833503-24833525 CCTGGCCAGCCGCCCCATCCGGG - Intronic
903748501 1:25604117-25604139 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
903921431 1:26803632-26803654 CCTGGCCAGCTGCCCCATCCAGG - Intergenic
904129211 1:28263134-28263156 CGTGACTAGTTGCCCCTTGCTGG + Intronic
904794990 1:33051908-33051930 CCCGGCCAGCTGCCCCATCCGGG + Intronic
906427483 1:45725434-45725456 CCTGGCCAGCCGCCCCATCCGGG + Intronic
906761553 1:48382729-48382751 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
906761652 1:48382926-48382948 CCTGGCCAGCCGCCCCATCCGGG - Intronic
906761706 1:48383053-48383075 CCTGGCCAGCCGCCCCATCCGGG - Intronic
906761848 1:48383369-48383391 CCTGGCCAGCCGCCCCATCCGGG - Intronic
908380628 1:63593913-63593935 CGTGGCCACTTTCCCCAGCCCGG - Intronic
908446250 1:64201489-64201511 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
909641013 1:77869983-77870005 CCCGGCCAGTCGCCCCATCCGGG - Intronic
910815696 1:91289017-91289039 CCCGGCCAGCTGCCCCATCCGGG - Intronic
911042090 1:93599088-93599110 CGTGGCCAGCTGGCCCAGGAAGG + Intronic
911351630 1:96762415-96762437 CCCGGCCAGCTGCCCCATCCGGG - Intronic
912116330 1:106412643-106412665 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
914231007 1:145764725-145764747 CCCGGCCAGCTGCCCCATCCAGG + Intronic
914746948 1:150508191-150508213 AGTGGTCAGTTGCCCCAGGATGG + Exonic
914987308 1:152472004-152472026 CCTGGCCAGCTGCCCCATCTGGG - Intergenic
916087463 1:161281578-161281600 CCTGGCCAGCTGCCCCGTCCGGG - Intronic
917375675 1:174349327-174349349 CCCGGCCAGTGGCCCCATCCGGG - Intronic
917375918 1:174349879-174349901 CCTGGCCAGCCGCCCCATCCAGG - Intronic
917859954 1:179135667-179135689 CCTGGCCAGCCGCCCCATCCGGG + Intronic
920152258 1:203919420-203919442 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
920628012 1:207622719-207622741 GGTGGCCAGCTGCCCCATCACGG + Intronic
921142593 1:212321162-212321184 CCTGGCCAGCCGCCCCATCCAGG - Intronic
921237839 1:213151189-213151211 CCTGGCCAGCCGCCCCATCCGGG - Intronic
921638419 1:217524047-217524069 CCTGGCCAGCCGCCCCATCCGGG - Intronic
922632982 1:227133358-227133380 CCTGGCCAGCTGCCCCATCCGGG + Intronic
922693011 1:227710651-227710673 CCTGGCCAGCTGCCCCTTCCGGG - Intergenic
923468220 1:234267604-234267626 CCTGGCCAGCCGCCCCATCCAGG - Intronic
1064108594 10:12519959-12519981 CCCGGCCAGTTGCCCCGTCCAGG - Intronic
1064358822 10:14644856-14644878 CGTGGCCAGCTGCACAAAGCAGG + Intronic
1064655184 10:17549509-17549531 AGTGGCCAGTTGCTCCCAGCAGG + Intergenic
1065594289 10:27296385-27296407 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1066085547 10:31970383-31970405 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1066952925 10:42138347-42138369 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1067391197 10:45865477-45865499 CCTGGCCAGCTGCCCCGTCCGGG - Intergenic
1069365715 10:67691857-67691879 CCTGGCCAGCTGCCCCGTCCGGG + Intronic
1069645389 10:69992930-69992952 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1070966682 10:80534684-80534706 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1071259618 10:83908239-83908261 CGAGGGCAGTTGTCCCAAGCTGG - Intergenic
1071285723 10:84142684-84142706 CTTGGCCAGTTCTCCCACGCCGG - Exonic
1072126697 10:92451754-92451776 AGTGGCCAGTTGGCTCAGGCAGG - Exonic
1073865596 10:107800829-107800851 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1074119330 10:110481760-110481782 CATGGCCAGATGTCCCCTGCGGG + Intergenic
1077397578 11:2332635-2332657 CCCGGCCAGTCGCCCCATCCGGG + Intergenic
1077397602 11:2332685-2332707 CCCGGCCAGTCGCCCCATCCGGG + Intergenic
1077668725 11:4137917-4137939 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1079039855 11:17050656-17050678 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1079371899 11:19859966-19859988 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1079371922 11:19860012-19860034 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1079479244 11:20863290-20863312 CCTGGCCAGCTGCCCCGTCCGGG - Intronic
1080187820 11:29511831-29511853 TGAGGCCAGCTGCACCATGCAGG + Intergenic
1080860314 11:36145273-36145295 CCCGGCCAGCTGCCCCATCCGGG + Intronic
1083091183 11:60201262-60201284 CCAGGCCAGCTGCCCCATCCGGG - Intronic
1083865512 11:65451288-65451310 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1083865589 11:65451465-65451487 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1083865683 11:65451690-65451712 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1084429531 11:69103421-69103443 CGGGGCCACTGCCCCCATGCAGG - Intergenic
1084652478 11:70497188-70497210 CGTGGCCAGTGGGATCATGCTGG + Intronic
1085731259 11:79001358-79001380 GGTGCTCAGTAGCCCCATGCAGG - Intronic
1085856562 11:80182050-80182072 AGTGTGCAGTAGCCCCATGCAGG + Intergenic
1087214809 11:95482751-95482773 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1089420887 11:118331383-118331405 CCTGGCCAGCTGCCCCATCCGGG - Intergenic
1090381310 11:126329470-126329492 CATGGCCACTGGCCCCAGGCTGG - Intronic
1090403833 11:126465721-126465743 CGTGGCCAGATGCAGCAAGCCGG + Intronic
1090684395 11:129099917-129099939 AGTGCACAGTAGCCCCATGCAGG - Intronic
1091321921 11:134657746-134657768 CGTGGCCAGGAGCCTCAGGCAGG + Intergenic
1091820420 12:3471603-3471625 GGTGAGCAGATGCCCCATGCTGG - Intronic
1092453885 12:8625939-8625961 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1092827618 12:12414178-12414200 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1096167278 12:49436369-49436391 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1096557112 12:52410085-52410107 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1097126932 12:56783462-56783484 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1097127885 12:56789277-56789299 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1097228586 12:57495187-57495209 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1097230389 12:57507503-57507525 CCCGGCCAGCCGCCCCATGCAGG - Intronic
1098412670 12:70202094-70202116 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1098412813 12:70202407-70202429 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1098412867 12:70202534-70202556 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1098412967 12:70202731-70202753 CCTGGCCAGTCGCCCCGTCCGGG + Intergenic
1100570542 12:95841063-95841085 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1100995082 12:100294480-100294502 CCTGGCCAGCCGCCCCATCCTGG - Intronic
1101880755 12:108623966-108623988 CGTGGACAGGTTCCCCATGTTGG + Exonic
1103591397 12:121994044-121994066 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1104712700 12:130996980-130997002 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1105245339 13:18645233-18645255 CCTGGCCAGTTGTCCACTGCAGG + Intergenic
1105305670 13:19167131-19167153 AGTGCCCCTTTGCCCCATGCTGG - Intergenic
1105556005 13:21448210-21448232 CCCGGCCAGCTGCCCCATCCGGG + Intronic
1105976731 13:25480139-25480161 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1105980402 13:25512754-25512776 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1106114572 13:26806269-26806291 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1106312976 13:28569807-28569829 CATTCCCAGTTGCCCAATGCAGG - Intergenic
1106560096 13:30839572-30839594 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1106918772 13:34541085-34541107 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1107493172 13:40900715-40900737 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1107499052 13:40955693-40955715 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1108077633 13:46698142-46698164 CATGGCTAGCTGCCCAATGCTGG - Intronic
1108351490 13:49593344-49593366 CCTGGCCAGCCGCCCCATCCAGG + Intergenic
1108608627 13:52064019-52064041 CCCGGCCAGCTGCCCCATCCGGG + Intronic
1108608755 13:52064322-52064344 CCTGGCCAGCCGCCCCATCCAGG + Intronic
1111418162 13:87976259-87976281 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1111418290 13:87976561-87976583 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1112055900 13:95690585-95690607 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
1113329169 13:109311774-109311796 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1113457883 13:110461919-110461941 TGTGGCCAGTGGCCCCACACTGG + Intronic
1114427703 14:22637300-22637322 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1114427730 14:22637378-22637400 CCTGGCCAGTCGCCCCGTCCAGG + Intergenic
1114427832 14:22637603-22637625 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1114428029 14:22638047-22638069 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1115493915 14:33984435-33984457 CCCGGCCAGCTGCCCCATCCAGG - Intronic
1115609705 14:35039098-35039120 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1115703564 14:35977432-35977454 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1117277152 14:54203642-54203664 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1118148668 14:63165812-63165834 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1118253212 14:64182988-64183010 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
1118341037 14:64895369-64895391 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1118517472 14:66545354-66545376 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
1119521163 14:75286523-75286545 CGGGGCCTCTTGCCCCAGGCTGG + Intergenic
1121142732 14:91557182-91557204 CCTGGCCAGCTGCCCCGTCCTGG - Intergenic
1125861633 15:43005346-43005368 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1127154126 15:56109933-56109955 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1127584464 15:60367088-60367110 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1127824207 15:62689902-62689924 CCTGGCCAGCTGCCCCGTCCGGG - Intronic
1128587024 15:68859978-68860000 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1129351080 15:74956398-74956420 CGTGGCTGGCTGCGCCATGCTGG + Exonic
1131127323 15:89868183-89868205 CCTGGCCAGCTGCCCCGTCCGGG + Intronic
1132237440 15:100232725-100232747 CTTGGCCATTTGGCCCATGCGGG + Intronic
1132674017 16:1114261-1114283 AGTGGCCAGTAGCCCCTGGCCGG + Intergenic
1132954923 16:2586507-2586529 TGTGGCCAGGTGTCCCATGGAGG + Intronic
1134750107 16:16618992-16619014 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1136414490 16:30095378-30095400 CGGGGGCAGTGGCCCCACGCGGG + Exonic
1136572194 16:31104598-31104620 CCTGGCCAGTCGCCCCGTCCAGG + Intergenic
1136668632 16:31836697-31836719 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1136994945 16:35182894-35182916 GGTGGGCAGTGGCCCCATGATGG + Intergenic
1137439044 16:48483116-48483138 CCTGGCCAGCCGCCCCATCCAGG - Intergenic
1139885480 16:70204789-70204811 CCTGGCCAGCTGCCCCATCCGGG + Intergenic
1139948540 16:70658010-70658032 GGTGGCGAGATGACCCATGCAGG + Intronic
1140513405 16:75524850-75524872 CGTGGCCAGTGGCTCCATATTGG - Intergenic
1140994392 16:80244026-80244048 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1141824186 16:86467697-86467719 CTTGGCCAGTTGCCCCTCCCTGG + Intergenic
1142491309 17:281535-281557 TGTGGCCACTTCCCCTATGCAGG - Intronic
1142818624 17:2447546-2447568 CCTGGCCAGTCGCCCCGTCCAGG + Intronic
1142818751 17:2447821-2447843 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1145684556 17:26639115-26639137 CCCGGCCAGCCGCCCCATGCGGG + Intergenic
1145920204 17:28604326-28604348 CCAGGCCAGCTGCCCCATCCGGG - Intronic
1146216122 17:30979828-30979850 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1146444253 17:32922450-32922472 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1146444377 17:32922723-32922745 CCCGGCCAGTCGCCCCATCCAGG - Intergenic
1151162840 17:72180320-72180342 TGTGGCCAGTTCATCCATGCTGG + Intergenic
1152257820 17:79250520-79250542 CGTGGGCAGGAGCACCATGCAGG + Intronic
1152696081 17:81797746-81797768 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1152742928 17:82026282-82026304 GGTGGCCAGATGCCCCAGGATGG + Intronic
1154398179 18:14010684-14010706 CCCGGCCAGCTGCCCCATCCAGG - Intergenic
1154443607 18:14414714-14414736 CCTGGCCAGTTGTCCACTGCAGG - Intergenic
1157639879 18:49202922-49202944 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1157677244 18:49577765-49577787 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1160755861 19:756955-756977 CGTGACCAGATACCCCATCCTGG + Exonic
1161685861 19:5702274-5702296 CCAGGCCAGCTGCCCCATCCGGG + Intronic
1162281315 19:9700231-9700253 CGTGGCCAGTTCCCAGCTGCAGG - Intronic
1163945425 19:20530282-20530304 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1164012100 19:21212556-21212578 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1164066652 19:21721657-21721679 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1164168058 19:22700393-22700415 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1164168098 19:22700484-22700506 CCTGGCCAGCTGCCCCGTCCGGG - Intergenic
1164256604 19:23533484-23533506 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1165013571 19:32865200-32865222 CCTGGCCAGAGGCTCCATGCAGG + Intronic
1166047415 19:40237730-40237752 TGTGGCAAGTTGCCCCAAGTAGG - Intronic
1166421371 19:42639497-42639519 CGCGGCCAGCCGCCCCATCCGGG - Intronic
1166492696 19:43272107-43272129 AGTGGTCAGTGACCCCATGCAGG - Intergenic
1167970618 19:53186802-53186824 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
1167970716 19:53187022-53187044 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
1167970845 19:53187298-53187320 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1167970988 19:53187612-53187634 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1168115890 19:54221214-54221236 CCTGGCCAGCAGCCCCAGGCTGG - Exonic
1168118873 19:54240962-54240984 CCTGGCCAGCAGCCCCAGGCTGG - Exonic
1168185595 19:54697792-54697814 CCTGGCCAGCAGCCCCAGGCTGG + Intronic
925224633 2:2172638-2172660 TGTGGCCAGGAGCCCCGTGCTGG + Intronic
925224676 2:2172798-2172820 TGTGGCCAGAAGCCCCGTGCTGG + Intronic
925403315 2:3590729-3590751 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
925403565 2:3591276-3591298 CCTGGCCAGTCGCCCCGTCCAGG - Intergenic
928005278 2:27557736-27557758 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
928005377 2:27557933-27557955 CCTGGCCAGCCGCCCCATCCGGG - Intronic
928596944 2:32868716-32868738 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
929447717 2:42014428-42014450 CCTGGCCAGCTGCCCCGTCCGGG - Intergenic
929739965 2:44589279-44589301 CCTGGCCAGCCGCCCCATCCGGG + Intronic
931479937 2:62630419-62630441 CCCGGCCAGGTGCCCCATCCGGG + Intergenic
932710665 2:74061262-74061284 CCTGGCCAGCCGCCCCATCCGGG - Intronic
932854776 2:75221663-75221685 AGTGGCCATCTGCCCCATGGTGG - Intergenic
933735052 2:85488046-85488068 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
934555619 2:95285661-95285683 CTGGGCCAGCTGCTCCATGCTGG - Exonic
934761398 2:96858881-96858903 TGTGGCCACCTGCCCCTTGCTGG - Intergenic
935630631 2:105210693-105210715 CATGGCCAGCCGCCCCATCCGGG - Intergenic
935957261 2:108389727-108389749 TTTTGCCAGTTGCCCCAGGCTGG + Intergenic
937323864 2:120977495-120977517 AGTGACCACTTGCCCCATGTGGG - Intronic
937919502 2:127119854-127119876 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
939100528 2:137890355-137890377 CCTGGCCAGTTGTCCACTGCAGG + Intergenic
940122211 2:150279255-150279277 TGAGGGCAGTTTCCCCATGCTGG + Intergenic
940299238 2:152160716-152160738 CCTGGCCAGCTGCCCCATCCGGG + Intronic
940299315 2:152160892-152160914 CCTGGCCAGCCGCCCCATCCGGG + Intronic
940643574 2:156369074-156369096 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
941768818 2:169327201-169327223 CCTGGCCAGCCGCCCCATCCGGG + Intronic
942630189 2:177945747-177945769 CCCGGCCAGCTGCCCCATCCGGG + Intronic
942754090 2:179319603-179319625 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
943863243 2:192894337-192894359 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
945233039 2:207610810-207610832 CCTGGCCAGCCGCCCCATCCGGG + Exonic
945233091 2:207610937-207610959 CCTGGCCAGCTGCCCCATCCGGG + Exonic
945233114 2:207610986-207611008 CCTGGCCAGTCGCCCCGTCCGGG + Exonic
945970302 2:216226417-216226439 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
946318207 2:218931741-218931763 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
947338020 2:229107171-229107193 CGTGGCCATTTTCCCCAAGAAGG - Intronic
947613089 2:231536002-231536024 CGTGGACACTGGCCCCAGGCTGG + Intergenic
948291825 2:236831365-236831387 CGTGGCCAGCTGTCTCATGGGGG + Intergenic
948464469 2:238145621-238145643 CATGGCCTGGTGCCCCAGGCTGG + Intronic
948540732 2:238690037-238690059 TGTGGCCAACTGCCCCAGGCAGG - Intergenic
1169085878 20:2824383-2824405 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1169247063 20:4033068-4033090 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1171366003 20:24625963-24625985 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1172051489 20:32122048-32122070 CCTGGCCAGCTGCCCCGTCCCGG - Intronic
1172337971 20:34132761-34132783 CCCGGCCAGTCGCCCCATCCGGG + Intergenic
1172721268 20:37000993-37001015 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1173337934 20:42128109-42128131 CCTGGCCAGTTGCTCCATCTTGG + Intronic
1173913136 20:46685159-46685181 CCTGGCCATCCGCCCCATGCTGG + Exonic
1174218650 20:48935918-48935940 CCCGGCCAGCCGCCCCATGCGGG - Intronic
1174218704 20:48936046-48936068 CCCGGCCAGCCGCCCCATGCGGG - Intronic
1174344976 20:49922514-49922536 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1174878421 20:54250759-54250781 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1176140645 20:63543280-63543302 CCTGCCAAGCTGCCCCATGCTGG - Intronic
1177178462 21:17720509-17720531 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1178075713 21:29011910-29011932 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1178812596 21:35897749-35897771 CCCGGCCAGCTGCCCCATCCGGG + Intronic
1178979037 21:37245416-37245438 CGTGGGCAGTTGCCTAAGGCTGG - Intronic
1179383373 21:40919874-40919896 TGTGGTCATTTCCCCCATGCTGG + Intergenic
1179571832 21:42283061-42283083 CCTGTCCAGTTGTCCCAGGCAGG + Intronic
1180142936 21:45903276-45903298 CGTGGCCAGTTGCCCCATGCAGG + Intronic
1180600704 22:17013270-17013292 TGTGTCCACTGGCCCCATGCTGG - Intergenic
1180621879 22:17167786-17167808 CAGGGCCAGTTGCGCCAGGCTGG + Intergenic
1181039140 22:20183779-20183801 TGTGCCCAGGTGCCCCAGGCAGG - Intergenic
1181301470 22:21883811-21883833 CCTGGCCAGCTGCCCCATCCGGG - Intergenic
1181301498 22:21883889-21883911 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1181586246 22:23854925-23854947 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1181586300 22:23855052-23855074 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1181586398 22:23855249-23855271 CCTGGCCAGTCGCCCCGTCCGGG + Intergenic
1182976232 22:34626022-34626044 CCTGGCCAGCTGCCCCATCCGGG - Intergenic
1183503919 22:38198265-38198287 CGTGGCAATTTGCCCCTTACTGG + Intronic
1183841419 22:40502001-40502023 CCTGGCCAGCTGCCCCGTCCGGG - Intronic
1183871563 22:40745203-40745225 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1203247555 22_KI270733v1_random:85171-85193 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1203247597 22_KI270733v1_random:85268-85290 CCTGGCCAGCCACCCCATGCGGG - Intergenic
950949028 3:16979987-16980009 CCCGGCCAGCTGCCCCATCCAGG - Intronic
954399275 3:50311413-50311435 CCTGGCCAGCCGCCCCATCCGGG - Intronic
954399450 3:50311816-50311838 CCTGGCCAGCCGCCCCATCCGGG - Intronic
954599867 3:51858997-51859019 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
955674478 3:61434744-61434766 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
956584509 3:70850230-70850252 CCTGGCATGTTGCCACATGCTGG - Intergenic
957035606 3:75289857-75289879 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
957316757 3:78583405-78583427 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
958808626 3:98837536-98837558 CCCGGCCAGCTGCCCCATCCGGG - Intronic
959299299 3:104577943-104577965 TGGGGGCAGTTTCCCCATGCTGG - Intergenic
959415688 3:106074818-106074840 CCCGGCCAGTCGCCCCATCCAGG - Intergenic
960030034 3:113046563-113046585 CCTGGCCAGCTGCCCCGTCCGGG - Intergenic
961120693 3:124368110-124368132 CCTGGCCAGCTGCCCCGTCCGGG - Intronic
961163746 3:124750230-124750252 CCTGGCCAGCTGCCCCATCCGGG - Intergenic
961365692 3:126397999-126398021 CCTACCCAGTTGGCCCATGCTGG - Intronic
962574065 3:136739479-136739501 CGGAGTCTGTTGCCCCATGCTGG - Intronic
963244427 3:143047017-143047039 CCTGGCCAGCCGCCCCATCCAGG - Intronic
963911472 3:150820718-150820740 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
964723553 3:159791484-159791506 GGTTGCCAGATGCCCCAAGCAGG - Intronic
967177658 3:186874408-186874430 CCTGGCCAGCCGCCCCATCCAGG + Intergenic
967524323 3:190473594-190473616 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
968316748 3:197731720-197731742 CCCGGCCAGTCGCCCCATCCGGG - Intronic
968411685 4:395842-395864 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
968688097 4:1975022-1975044 CATAGCCAGGAGCCCCATGCAGG - Intronic
968924138 4:3538546-3538568 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
968924162 4:3538595-3538617 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
968924279 4:3538898-3538920 CCTGGCCAGCTGCCCCATCCGGG - Intergenic
969374802 4:6756004-6756026 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
969404218 4:6978086-6978108 CCTGGCCAGCCGCCCCATCCGGG + Intronic
969448668 4:7260234-7260256 TCTGGCCAGTTGCCCCCTGAGGG + Intronic
970472581 4:16393180-16393202 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
971242251 4:24899407-24899429 CATGGCCAGTAGCCACATGGAGG + Intronic
971330261 4:25676086-25676108 AGGGGCCTGTTGCCCAATGCGGG - Intronic
974076671 4:57173482-57173504 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
974525238 4:63042763-63042785 AGTGGCCACAGGCCCCATGCAGG + Intergenic
974870644 4:67637331-67637353 CCTGGCCAGCTGCCCCGTCCGGG + Intronic
975042539 4:69762334-69762356 CCTGGCCAGCCGCCCCATCCGGG + Intronic
975685647 4:76917017-76917039 CCTGGCCAGTCGCCCCGTCCAGG + Intergenic
975685999 4:76917815-76917837 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
975793625 4:77983814-77983836 CCTGGCCAGCTGCCCCGTCCGGG - Intergenic
978518967 4:109597606-109597628 CCCGGCCAGCTGCCCCATCCGGG - Intronic
982293795 4:153806329-153806351 CGTGGCCAGCTGGCGCCTGCTGG + Intergenic
982784490 4:159523950-159523972 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
984803552 4:183735387-183735409 CCTGGCCAGCTGCCCCGTCCGGG - Intergenic
984804025 4:183736478-183736500 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
985635067 5:1031840-1031862 CTTGGCCAGGGCCCCCATGCTGG - Intronic
985736547 5:1586475-1586497 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
987914897 5:24200273-24200295 GGTGTGCAGTAGCCCCATGCAGG - Intergenic
989587573 5:43087343-43087365 CCTGGCCAGCCGCCCCATCCGGG - Intronic
989587949 5:43088191-43088213 CCTGGCCAGTCGCCCCGTCCAGG - Intronic
989828953 5:45890918-45890940 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
990513337 5:56509353-56509375 AGAGGCCAGAGGCCCCATGCAGG - Intergenic
991537240 5:67683473-67683495 CGCGGCCAGATGCCCCTTTCAGG + Intergenic
991910032 5:71551873-71551895 CCTGGCCAGCTGCCCCGTCCGGG - Intronic
992415752 5:76550955-76550977 CCCGGCCAGTCGCCCCATCCGGG - Intronic
992978129 5:82139908-82139930 CCTGGCCAGCCGCCCCATCCGGG + Intronic
993799754 5:92318454-92318476 GGTGAGCAGTTTCCCCATGCTGG + Intergenic
996070026 5:119122410-119122432 CCCGGCCAGCTGCCCCATCCGGG - Intronic
998432151 5:142076410-142076432 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
998442356 5:142173120-142173142 CTTGCCCCGTTGCCCCAGGCTGG - Intergenic
1001024913 5:168215854-168215876 CGTGGCCAGAGGCCCCTCGCTGG - Intronic
1002417149 5:179126550-179126572 CGTGGCCAAATGTCCCCTGCTGG - Intronic
1005069620 6:21851595-21851617 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1005158811 6:22836670-22836692 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1005158863 6:22836798-22836820 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1005158989 6:22837102-22837124 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1006064727 6:31454830-31454852 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1006065004 6:31455485-31455507 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1008926457 6:56894825-56894847 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1009913714 6:69966166-69966188 CCCGGCCAGCTGCCCCGTGCGGG + Intronic
1010245784 6:73660442-73660464 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1010245884 6:73660667-73660689 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1010264397 6:73851121-73851143 CCAGGCCAGCTGCCCCATCCGGG - Intergenic
1011291395 6:85781133-85781155 CCTGGCCAGCCGCCCCATCCAGG + Intergenic
1011476023 6:87751069-87751091 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1013204801 6:107935088-107935110 CCTGGCCAGCTGCCCCGTCCGGG + Intronic
1013259366 6:108425354-108425376 TGTGATCAGTTGCCCCATACTGG + Intronic
1013992218 6:116266078-116266100 GGTGTGCAGTAGCCCCATGCAGG + Intronic
1014671799 6:124313720-124313742 GGTGGCCGGTTTCCCCATGCTGG + Intronic
1015476701 6:133664900-133664922 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1016308578 6:142709856-142709878 CTTGCCCTGTTGCCCCAGGCTGG + Intergenic
1018528148 6:164736240-164736262 CCTGGCCAGCCGCCCCATCCAGG - Intergenic
1019373277 7:674810-674832 GGTGCCCAGTTACCCCAAGCAGG - Intronic
1019458774 7:1146334-1146356 CCTGGCCAGTCGCCCCGTCCGGG - Intergenic
1019458873 7:1146553-1146575 CCTGGCCAGTCGCCCCGTCCGGG - Intergenic
1019458926 7:1146680-1146702 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1019459069 7:1146994-1147016 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1019669041 7:2268133-2268155 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1019699780 7:2469023-2469045 CGGGTCCACCTGCCCCATGCTGG + Intergenic
1019714871 7:2534170-2534192 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1021440477 7:20669121-20669143 CCCGGCCAGCTGCCCCATCCGGG + Intronic
1022663475 7:32387600-32387622 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1022700401 7:32754135-32754157 CCTGGCCAGCCGCCCCATTCGGG + Intergenic
1025103259 7:56151472-56151494 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1025103435 7:56151874-56151896 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1025853033 7:65258663-65258685 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1025853217 7:65259064-65259086 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1025979332 7:66393848-66393870 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1026892841 7:73992459-73992481 CGTGGGCCCTTGCCCCAGGCGGG - Intergenic
1027371111 7:77509300-77509322 CCCGGCCAGCTGCCCCATCCGGG + Intergenic
1034210659 7:149359255-149359277 AGTGGCCACTTGCATCATGCTGG - Intergenic
1034638643 7:152585952-152585974 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1034638783 7:152586265-152586287 CCTGGCCAGGCGCCCCATCCGGG - Intergenic
1038292650 8:26263718-26263740 GGGGCCCAGTTTCCCCATGCTGG + Intergenic
1040043394 8:42939415-42939437 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1040069724 8:43179632-43179654 CCTGGCCAGTCGCCCCGTCCGGG - Intronic
1040069747 8:43179681-43179703 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1040069801 8:43179808-43179830 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1040093234 8:43419398-43419420 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1041495963 8:58485697-58485719 CCTGGGCCTTTGCCCCATGCCGG + Intergenic
1042303714 8:67311307-67311329 CCCGGCCAGCTGCCCCATCCAGG + Intronic
1045120363 8:99028738-99028760 CCCGGCCAGTTGCCCCGTCCAGG - Intronic
1045298576 8:100892423-100892445 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1047687563 8:127317099-127317121 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1049479052 8:142811337-142811359 CGTGCCCATGTGCCCCATGAGGG + Intergenic
1049732862 8:144187748-144187770 GGTGGCCAGTGGCCCCATGAAGG + Intronic
1051258151 9:15234375-15234397 CCCGGCCAGCTGCCCCATCCAGG + Intronic
1051280893 9:15442034-15442056 CCTGGCCAGCTGCCCCATCCAGG - Intronic
1052492591 9:29188673-29188695 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1053530701 9:38878586-38878608 GGTGTGCAGTAGCCCCATGCAGG - Intergenic
1054202924 9:62103019-62103041 GGTGTGCAGTAGCCCCATGCAGG - Intergenic
1054635439 9:67485346-67485368 GGTGTGCAGTAGCCCCATGCAGG + Intergenic
1055137405 9:72841253-72841275 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1055586163 9:77761292-77761314 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1055586410 9:77761868-77761890 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1055586511 9:77762092-77762114 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1055586663 9:77762443-77762465 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1056564217 9:87758663-87758685 CCTGGCCAGTCGCCCCGTCCGGG - Intergenic
1057253744 9:93526061-93526083 GCAGGCCAGTTGACCCATGCTGG + Intronic
1057751555 9:97796764-97796786 CCCGGCCAGCCGCCCCATGCGGG + Intergenic
1058018914 9:100068096-100068118 CCCGGCCAGCTGCCCCATCCAGG + Intronic
1059879851 9:118678032-118678054 CCCGGCCAGCTGCCCCATCCAGG - Intergenic
1060148029 9:121268517-121268539 CCGGGCCAGTTCCCCCATCCCGG - Intronic
1060350290 9:122852776-122852798 CCTGGCCAGCCGCCCCATCCGGG + Intronic
1060861153 9:126956060-126956082 AGTAGACAGTGGCCCCATGCAGG - Intronic
1061831670 9:133300185-133300207 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1061930374 9:133829431-133829453 CGTGGCCAGTGGCTCTGTGCCGG - Intronic
1061996841 9:134190492-134190514 CGAGGCCAGCAGCCCCATGGTGG + Intergenic
1062681210 9:137782370-137782392 CGTGGACATCTGCCACATGCTGG + Exonic
1203463961 Un_GL000220v1:68406-68428 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1203464003 Un_GL000220v1:68503-68525 CCTGGCCAGCCACCCCATGCGGG - Intergenic
1203405804 Un_KI270539v1:871-893 CCCGGCCAGCCGCCCCATGCGGG + Intergenic
1185866093 X:3625290-3625312 CGTAGCCAGTGGCCCCATAAGGG + Intronic
1186787002 X:12963668-12963690 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1188367444 X:29333248-29333270 CCCGGCCAGCTGCCCCATCCGGG - Intronic
1188367571 X:29333552-29333574 CCTGGCCAGCCGCCCCATCCTGG - Intronic
1189210464 X:39278278-39278300 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1189569975 X:42285682-42285704 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1189837633 X:45040467-45040489 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1190171569 X:48115567-48115589 CCTGGCCAGCTGCCCCGTCCGGG + Intergenic
1190505222 X:51119569-51119591 CCCGGCCAGCTGCCCCATCCGGG - Intergenic
1191009942 X:55748802-55748824 CCTGGCCAGCTGCCCCGTCCGGG + Intronic
1192352811 X:70371624-70371646 CCTGGCCAGCCGCCCCATCCGGG - Intronic
1192530195 X:71876889-71876911 CCTGGCCAGCCGCCCCATCCGGG - Intergenic
1192567783 X:72178929-72178951 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1194991865 X:100555496-100555518 CCTGGCCAGCCGCCCCATCCGGG + Intergenic
1197455790 X:126674281-126674303 CCTGGCCAGCCGCCCCATCCAGG + Intergenic
1200212528 X:154353118-154353140 CGTGGCCAGCAGCCCCATCCCGG - Exonic