ID: 1180149365

View in Genome Browser
Species Human (GRCh38)
Location 21:45939863-45939885
Sequence CCTGCAGGCAGGTGTGGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 580
Summary {0: 1, 1: 1, 2: 7, 3: 61, 4: 510}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180149352_1180149365 12 Left 1180149352 21:45939828-45939850 CCTGACCTCGGGCAGGTGGCCTG 0: 1
1: 0
2: 0
3: 23
4: 277
Right 1180149365 21:45939863-45939885 CCTGCAGGCAGGTGTGGGCGGGG 0: 1
1: 1
2: 7
3: 61
4: 510
1180149356_1180149365 -7 Left 1180149356 21:45939847-45939869 CCTGGATCAGGCACCACCTGCAG 0: 1
1: 0
2: 3
3: 23
4: 259
Right 1180149365 21:45939863-45939885 CCTGCAGGCAGGTGTGGGCGGGG 0: 1
1: 1
2: 7
3: 61
4: 510
1180149354_1180149365 7 Left 1180149354 21:45939833-45939855 CCTCGGGCAGGTGGCCTGGATCA 0: 1
1: 0
2: 0
3: 14
4: 155
Right 1180149365 21:45939863-45939885 CCTGCAGGCAGGTGTGGGCGGGG 0: 1
1: 1
2: 7
3: 61
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180149365 Original CRISPR CCTGCAGGCAGGTGTGGGCG GGG Intronic