ID: 1180149634

View in Genome Browser
Species Human (GRCh38)
Location 21:45940988-45941010
Sequence GGGCCCTGGAACCCCTGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 301}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180149628_1180149634 2 Left 1180149628 21:45940963-45940985 CCTCTAGGTGGACACAGCCCTGC 0: 1
1: 4
2: 2
3: 43
4: 208
Right 1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG 0: 1
1: 0
2: 2
3: 34
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180149634 Original CRISPR GGGCCCTGGAACCCCTGTCC CGG Intronic
900140561 1:1137834-1137856 GGGCCCGGGGTCCTCTGTCCAGG + Intergenic
900157841 1:1210731-1210753 GGGCCCTGGGACCCCCTTCCAGG + Intergenic
900159736 1:1217863-1217885 GGGCCCCGGAAGGCCTGCCCGGG + Intronic
900575880 1:3382259-3382281 CGCCCCTGCCACCCCTGTCCTGG + Intronic
900800601 1:4734803-4734825 GGGCCTTAGAAACCTTGTCCGGG - Intronic
901379839 1:8865741-8865763 GTGCCCAGGAACAGCTGTCCTGG + Intronic
901462061 1:9397865-9397887 GAGCCCAGGGTCCCCTGTCCAGG + Intergenic
901886984 1:12230209-12230231 GGGCCCGGGCCCCCATGTCCAGG - Intronic
901893047 1:12284607-12284629 GAGCCCTGGAACCCCGGCCGTGG + Intronic
902155505 1:14482265-14482287 GGGCCCTGGCTCCCCAGTCATGG - Intergenic
902604607 1:17561836-17561858 TTGCCCTGGAAAGCCTGTCCTGG + Intronic
903801866 1:25974763-25974785 GGGCCCTGGTACCCCCCTCCTGG - Intronic
903826036 1:26146348-26146370 GGGTCTTGGCACCCCTGTCTTGG - Intergenic
903853355 1:26321197-26321219 GAGACCTGGATGCCCTGTCCTGG + Intergenic
904768838 1:32870161-32870183 GGGCCCCGGCACCCCTGATCTGG - Intronic
905179257 1:36156336-36156358 GCGCCGCGGGACCCCTGTCCTGG + Exonic
905362519 1:37430522-37430544 GGGCCCTGGAGCCCCACTCAGGG + Intergenic
905632585 1:39526921-39526943 GAGGCCTGGAGGCCCTGTCCTGG - Intergenic
906097430 1:43233862-43233884 GGGACGTGGAAGCCCTGGCCAGG + Intronic
912369359 1:109161761-109161783 GGGCCCTGGGACCCCGGGCAGGG - Intronic
916674571 1:167054705-167054727 GTGGCCTGGAGCCCCTGTCACGG - Intronic
917259074 1:173148036-173148058 TGCCCCTGGAAGCTCTGTCCAGG + Intergenic
919724475 1:200873050-200873072 GAGCCCTGGAGCCCCAGCCCGGG + Exonic
919809740 1:201400946-201400968 GGTCCCTGGATCCTCTGACCCGG + Intergenic
920301289 1:204990675-204990697 GGAGCCTGGAGCCCCTCTCCTGG - Intronic
920376351 1:205510444-205510466 GGGCTCTGTGACCCCTTTCCTGG - Intronic
920387135 1:205577106-205577128 GGGGTCAGGAAGCCCTGTCCAGG - Intronic
922232520 1:223699421-223699443 GGACCCTGGAACACCTGTGATGG + Intergenic
922588126 1:226751198-226751220 TAGCCCTGGAACCCCAGTCCCGG - Intergenic
922720229 1:227896506-227896528 GCTCCCTGGATCCTCTGTCCTGG - Intergenic
922725728 1:227922205-227922227 CGGCCCTGGAGCCTCTGTCTTGG - Intronic
924621270 1:245663160-245663182 GGGGCCTGGAACCTCTCTCCTGG + Intronic
1062845086 10:697427-697449 GGGCCCTGGATCCCCGTTCCTGG + Intergenic
1062902415 10:1156273-1156295 GGGCCCTGTATCCCCAGTGCAGG + Intergenic
1062956671 10:1544597-1544619 CGCCCCTGTACCCCCTGTCCAGG - Intronic
1063093690 10:2890485-2890507 AGGCCCTGGATCCGCTGTCAGGG - Intergenic
1063592413 10:7407536-7407558 GGGCCCCGGAACCCCAAACCCGG + Intronic
1069438589 10:68407494-68407516 GGGCCCTCGGTCCCGTGTCCCGG + Intergenic
1069726441 10:70583148-70583170 GGTCCATGGAACTCCTGTGCGGG + Intergenic
1069750894 10:70744298-70744320 GGGCCCTGGGGCCCATCTCCAGG + Intronic
1069913258 10:71772477-71772499 AGGCCCTGGTACCCATGGCCTGG - Intronic
1069984826 10:72275875-72275897 GGGGGCTGGAACCCCTCCCCGGG + Exonic
1070157936 10:73847838-73847860 GGGCCCTGGATGCCCATTCCTGG + Intronic
1072611197 10:97018641-97018663 GGCCACTGGAACAGCTGTCCAGG + Exonic
1074429106 10:113378111-113378133 GGGTCCTGGAACCCATGTTAGGG + Intergenic
1075584914 10:123650682-123650704 GGGCCCTGGCTCCCCTGGGCTGG - Intergenic
1076684091 10:132189147-132189169 GGGCCCTGGAAACCCAGAGCAGG + Intronic
1076843348 10:133057270-133057292 GGGCCGTGGGGCCCCTGTGCTGG - Intergenic
1077035239 11:491276-491298 GGGGCCTGGAACCCGGGTGCTGG + Exonic
1077064805 11:636503-636525 GGTCCCGGGACCCCCTGCCCAGG + Intergenic
1077130525 11:970041-970063 GGGCCCGGCCACCCCTCTCCTGG + Intronic
1077377883 11:2214032-2214054 GGGCCGTGGAACCCCTCTATGGG - Intergenic
1077418367 11:2436494-2436516 GGGCCCAGGCAGGCCTGTCCGGG - Intergenic
1081574678 11:44311521-44311543 GCGCCCTGGAACCTCTGCTCAGG + Intergenic
1081578170 11:44332646-44332668 GGGCTCTGGATCCCATGTTCTGG - Intergenic
1081992708 11:47346417-47346439 GGGCCCAGGAAGCCCCGCCCAGG - Intronic
1083340403 11:61955448-61955470 GGTCCCTGGAGCCCCTGCGCGGG + Intronic
1083623545 11:64060445-64060467 GGGACCTGGGGCCCCTGTCGGGG + Intronic
1083748398 11:64747386-64747408 GGAGCCAGGAACCCCTTTCCGGG - Intronic
1083996739 11:66276687-66276709 GGGCCCTGGATCCCAGGTCCTGG - Exonic
1084219804 11:67670953-67670975 GGGCCCTGGAACCTGGGACCTGG - Intronic
1084527548 11:69706115-69706137 TGACCCCGGAGCCCCTGTCCCGG - Intergenic
1084604165 11:70162710-70162732 GGGCCCTGGGACCCTGGGCCAGG - Intronic
1084657607 11:70528406-70528428 GGGACCTGGAGCCCCTTTCCAGG - Intronic
1085307416 11:75495838-75495860 GGGGCCTAGACCCCCTGTGCTGG + Intronic
1085312606 11:75525388-75525410 GCGCCCGGGAAGCCCTGGCCGGG - Exonic
1087150645 11:94856538-94856560 AGGCCCTGGATCCCCTTTCCCGG - Intronic
1088894075 11:114064652-114064674 GGGGCCTGGCTCCCCTGTCTTGG + Intronic
1090391898 11:126394247-126394269 GCGCCCGGGAGCCCCTGACCAGG + Intronic
1090461679 11:126896701-126896723 TGGCCATGGAACCCCTCCCCTGG - Intronic
1091689275 12:2584636-2584658 GAGCCCTGGAGCCCCAGGCCTGG - Intronic
1091869152 12:3873076-3873098 AGGCCCGGGAACTCCGGTCCCGG + Intronic
1094818277 12:34206543-34206565 GCGGCCTTGAACCCCTGTTCTGG + Intergenic
1095098926 12:38161993-38162015 GGGCCCTGGGCCCACGGTCCTGG + Intergenic
1096659991 12:53118346-53118368 GGGGCCTGGATCCCCTCACCTGG - Exonic
1096660081 12:53118810-53118832 GGGCCCCAGAACCCGTGCCCAGG + Intronic
1100532641 12:95474405-95474427 GGGCTCTGGGGCCCCGGTCCCGG - Intronic
1103722534 12:122982371-122982393 GAGCCCTGGGACCCCTCTGCCGG + Intronic
1104483588 12:129130127-129130149 TGTCCCTGGAACCCCTCTCTAGG + Intronic
1105412631 13:20184188-20184210 GAGCCATGGAACCACTGTTCTGG - Intergenic
1106092047 13:26604984-26605006 GGACCCTGGCGCCTCTGTCCAGG - Intronic
1106594141 13:31122685-31122707 GGGCAAGGGGACCCCTGTCCTGG + Intergenic
1110119518 13:71865499-71865521 TGGCCGTGGAACCCAGGTCCTGG + Intronic
1112451930 13:99520408-99520430 GGGTCCTGAAACCCGGGTCCTGG + Intronic
1112503216 13:99957662-99957684 GGGCCAAGGAACGCCTGGCCGGG - Intergenic
1113753339 13:112791497-112791519 GGGTCCTGGTACCCCTGGCAGGG + Intronic
1113787470 13:113010131-113010153 GGGCCCTGGAAATCCTCTCATGG - Intronic
1113928483 13:113953888-113953910 GGGCCCTGGACGGGCTGTCCTGG - Intergenic
1113968129 13:114166327-114166349 GAGCCCTGGGGCCTCTGTCCAGG - Intergenic
1113970539 13:114185378-114185400 GGGACCTGGAACCCCCACCCCGG + Intergenic
1115753625 14:36513888-36513910 GGGCCCTGAAACCCCAGGCTGGG - Intergenic
1118613874 14:67562234-67562256 GGGCCTGGGAGCCACTGTCCTGG - Exonic
1121995475 14:98599097-98599119 GGAGCCTGTAACTCCTGTCCTGG + Intergenic
1122287336 14:100659576-100659598 AGGCCCCGGAATCCCTGTCTGGG - Intergenic
1122607049 14:102953686-102953708 GGGCCCCTGCTCCCCTGTCCTGG - Intronic
1122627232 14:103090837-103090859 GGCCCCTGGCACACCTGCCCGGG - Intergenic
1123012571 14:105356462-105356484 GGGCCCTGGGACCCCTCTGGTGG + Intronic
1125513288 15:40304136-40304158 GAGCTCTGAAACCCCTGGCCTGG - Intronic
1125768546 15:42150546-42150568 TGGCCCTGGAACGCCAGTCTGGG + Intronic
1127979894 15:64026731-64026753 GGGACCTGGAACTCCTGCCAAGG - Intronic
1129319762 15:74767979-74768001 GGGGCCTGGAGCCCCTCTCTGGG - Intergenic
1129664617 15:77572606-77572628 TGGCACTGGAACAGCTGTCCAGG + Intergenic
1130062235 15:80578310-80578332 AGGCCCTTGCACCCCTGCCCTGG - Intronic
1130151866 15:81317424-81317446 GTGCCCTGGATCCCCTGGCCTGG - Intronic
1130893166 15:88150449-88150471 GGGTCCTGGGACCCCTGTTAAGG + Intronic
1131273169 15:90959120-90959142 GGGCCCTGGGACCTCGGGCCTGG + Intronic
1131509899 15:93044165-93044187 GGGCCCAGGCACCCCTGCCCAGG + Intronic
1131510704 15:93048092-93048114 AGGTTCTGGAACCCCTTTCCAGG - Intronic
1132141844 15:99403401-99403423 AGGCCCAGGAGCCCCTTTCCTGG - Intergenic
1132461822 16:59209-59231 GGGCCCTGAGACCCCCGACCCGG + Intronic
1135290697 16:21235450-21235472 GGGCCCAGGAAGCCATGTCTTGG + Intronic
1136318372 16:29466916-29466938 GGGGCCTGGCACCCCCGCCCTGG + Exonic
1136432947 16:30206265-30206287 GGGGCCTGGCACCCCCGCCCTGG + Exonic
1136505550 16:30700670-30700692 GGGCCCTGGAAGGCGGGTCCCGG + Exonic
1136551423 16:30984443-30984465 GGGCTCTGCACCCCCAGTCCTGG + Exonic
1137897403 16:52228867-52228889 GGGCTTTGGAAGCCCTGACCAGG - Intergenic
1138413657 16:56858880-56858902 GGGCCCTGGAACTCATAGCCAGG + Intergenic
1138431980 16:56974921-56974943 GGAACAGGGAACCCCTGTCCCGG - Intronic
1139580393 16:67869922-67869944 GGACTCAGGAAGCCCTGTCCCGG - Intronic
1139691864 16:68646316-68646338 GGGCCCTGGCACACCTGGGCTGG + Intronic
1141282241 16:82639258-82639280 GGGCCCTGGACTTCCTGTCTGGG + Intronic
1141769028 16:86077699-86077721 GGGCTCTGGGACGCCAGTCCGGG + Intergenic
1141978777 16:87536371-87536393 GGGCCCTTGAGCCCCTATGCCGG - Intergenic
1142265611 16:89062821-89062843 GGGCCCAGAATCCCCGGTCCAGG - Intergenic
1142468582 17:149281-149303 GGGCCCAGGAATCTCTCTCCAGG - Intronic
1142644791 17:1304752-1304774 GGCCTCTTGCACCCCTGTCCTGG + Intergenic
1143097445 17:4486006-4486028 GGGCCTTGGCACCCCCATCCTGG + Intronic
1143319545 17:6059293-6059315 GGACCCTGGGCCCCCTCTCCGGG - Intronic
1143367037 17:6415156-6415178 GGGCACTAGGACCCCTGTCCAGG + Intronic
1143378921 17:6483665-6483687 GGTCCCCGGCACCCGTGTCCAGG + Exonic
1143529972 17:7497042-7497064 GAGCCCTGGAGCCACTGACCTGG - Exonic
1143896543 17:10141061-10141083 GGGCCCTGGAGCCACTTCCCTGG - Intronic
1147313070 17:39606447-39606469 TGGCCCCGGAGCCCCTGGCCCGG + Exonic
1148470550 17:47890333-47890355 TGCCCCTGGTTCCCCTGTCCAGG - Intergenic
1148558914 17:48594845-48594867 GGTCCTTGGAACCCCTTTTCCGG - Intronic
1148861082 17:50604635-50604657 GGGCCCTGGATCCCCAGACCTGG - Intronic
1149268945 17:54955922-54955944 GGGCCTTGGGACCCCTGACCTGG - Intronic
1149989629 17:61375411-61375433 GGGCCTTGGAACTCCTGCCTGGG + Intronic
1151662766 17:75527415-75527437 GGACCCCGGAAACCCTGTCCAGG - Intronic
1151666815 17:75549862-75549884 GGGCTCTGGGACTCCTTTCCAGG - Intronic
1152231684 17:79117135-79117157 GGGCCCAGGACCCCCTGAGCAGG + Intronic
1152252460 17:79219103-79219125 GGGCCCTTGAGCCCTTCTCCTGG + Intronic
1152603639 17:81277991-81278013 GTGCCCTTGAGCCCCTGCCCTGG - Intronic
1152759820 17:82101976-82101998 GGGCCCTGTGACCCTTGGCCTGG + Intronic
1152934529 17:83128313-83128335 TGGTCCTGGAGCCCCTTTCCAGG + Intergenic
1157188615 18:45561421-45561443 GGCCTCTGGAACACCTGGCCTGG - Intronic
1157688911 18:49664857-49664879 GGTCCCTGCAACCCATGACCAGG + Intergenic
1158312412 18:56172210-56172232 TGGCCCTGCTACCACTGTCCAGG + Intergenic
1159559978 18:69983703-69983725 TGGCTCTGCATCCCCTGTCCTGG - Intergenic
1160380174 18:78448481-78448503 TGTCCCTGAAACCCCTGCCCTGG - Intergenic
1160731668 19:644083-644105 GGGCCCTGGACCCCCCACCCTGG - Intergenic
1160803001 19:979253-979275 CGGCCCAGGAAACCCTTTCCTGG - Intergenic
1160930304 19:1567130-1567152 GGGCCCTCGAGCCCCTCTCTGGG + Intronic
1161124431 19:2547796-2547818 GGGCCTGGGAGCCTCTGTCCTGG - Intronic
1161477502 19:4494588-4494610 GGGCCCAGAAACTCCTGCCCTGG + Intronic
1161558643 19:4958323-4958345 GGGGCCTGGTAACACTGTCCTGG + Intronic
1161818908 19:6517027-6517049 TGGACCTGGAGCCCCAGTCCAGG - Intergenic
1161896027 19:7081092-7081114 GGTCCCAGGAGCCCCTGTCCAGG - Intronic
1163153469 19:15428052-15428074 GGGCCCTGGAGCCCCTCCCGGGG - Intronic
1166855872 19:45782413-45782435 GGGCCTGGCAGCCCCTGTCCAGG + Intronic
1166996210 19:46720825-46720847 CAGCCCTGGAACCCCTCACCTGG + Intronic
1168484327 19:56748120-56748142 GGGCCCTGGACTCCCTCTTCTGG + Intergenic
925170704 2:1748647-1748669 GGGCTTTGGAAGCTCTGTCCCGG + Intergenic
925196997 2:1933708-1933730 GGGCACTGGGCACCCTGTCCTGG - Intronic
925279045 2:2670044-2670066 GACCCCTGGAGCCCCTGACCTGG + Intergenic
927722935 2:25398413-25398435 GGGCCCTGACAGCTCTGTCCTGG - Intronic
927850096 2:26493461-26493483 GGGCCCTGCCATCCCTTTCCTGG - Intronic
928048210 2:27960756-27960778 GGGACCTGGAACTCAAGTCCAGG + Intronic
928435426 2:31251692-31251714 GGGAGCTGGAACCCCTGGCCTGG + Intronic
930086924 2:47504240-47504262 GGGCCCTGGAACTCATGCCTAGG + Intronic
931247454 2:60503380-60503402 GGCTCCTGGAATGCCTGTCCAGG - Intronic
932802035 2:74749564-74749586 GTGCCCTGGAATCCCAGCCCAGG + Intergenic
933980047 2:87541910-87541932 GTGCCTTGGAAACCCAGTCCTGG + Intergenic
934714695 2:96536852-96536874 GGGCCGCCGAGCCCCTGTCCGGG - Intronic
934849923 2:97691644-97691666 CGGCCCGGGAACTCCTGGCCAGG - Intergenic
935316728 2:101842313-101842335 GGGCTCTGGATCCCCTCTCGTGG + Intronic
936313776 2:111408881-111408903 GTGCCTTGGAAACCCAGTCCTGG - Intergenic
936931619 2:117795797-117795819 GGGCCCTCTAACCCCTGTAGTGG - Intergenic
937047739 2:118860965-118860987 GGGCTTTGAAACCCCTGTCTTGG - Intergenic
938383278 2:130848427-130848449 GGGCTCGGAAGCCCCTGTCCAGG - Intronic
941666239 2:168246799-168246821 GGGCCCTGGAAACCCAGGGCGGG + Intronic
945080818 2:206085392-206085414 AGGCCCTGACGCCCCTGTCCCGG + Intronic
946201321 2:218072490-218072512 TGGCCCTGGATACCTTGTCCTGG - Exonic
946225405 2:218261691-218261713 GGGGCCCTGATCCCCTGTCCTGG + Intronic
947613100 2:231536051-231536073 TTGCCCTGGACCCCCTGCCCCGG + Intergenic
947764058 2:232624486-232624508 AGGCCCTGGAGCCCCTGTGTTGG - Intronic
947984444 2:234436785-234436807 GAGCCCTGGAGTCCCTGTGCTGG + Intergenic
948757930 2:240169963-240169985 GGGCCCTGAAACCCCTGCTGTGG + Intergenic
948877051 2:240835091-240835113 GGGCCCTGGGACCCCTGGCATGG + Intergenic
948891829 2:240910581-240910603 TGGGTCTGGAACCCCAGTCCTGG + Intergenic
949075869 2:242057592-242057614 GGGTCCTGGAACCCCAGGCAGGG + Intergenic
1171312951 20:24160363-24160385 GGGCAAAGGAAGCCCTGTCCTGG - Intergenic
1171823590 20:29876114-29876136 GGGCCCAGGGCCCACTGTCCTGG - Intergenic
1172127501 20:32633672-32633694 GGGCTCTGGAGCCCCTGTCCAGG - Intergenic
1172268885 20:33641342-33641364 GGGCCCTGGATCCTGGGTCCTGG - Intronic
1172618828 20:36306784-36306806 GGGGCCCGGAACCCCTGTCCGGG + Intronic
1172636576 20:36414171-36414193 GGGGGCTGGGACCCCAGTCCTGG - Intronic
1172849006 20:37947237-37947259 TGGCCCTGGGCCCCGTGTCCCGG + Intergenic
1174366787 20:50061364-50061386 GGGCCCTGGGTCCCCTCTCCAGG + Intergenic
1174559234 20:51418067-51418089 TGACCCTGGGGCCCCTGTCCTGG + Intronic
1175815771 20:61882562-61882584 GGGCTCTGAAGCCCCTGGCCCGG + Intronic
1175844135 20:62049739-62049761 GGGCTCTGGAACCTCTGCCCGGG - Intronic
1175905243 20:62376449-62376471 GGGCCTGGGGAGCCCTGTCCAGG - Intergenic
1175929152 20:62485462-62485484 GAGCCCTGGATCCCCTGCCCTGG + Intergenic
1175939534 20:62531636-62531658 GGGCCCTGGGAGCCCTGGCAGGG + Intergenic
1176240365 20:64073073-64073095 GGGCACTGGAGCCCCTGCCCTGG + Intergenic
1176868572 21:14070439-14070461 GGGCCCTGGGCCCACGGTCCTGG - Intergenic
1178322362 21:31615140-31615162 GGTCCCAGGAACCCCTTCCCTGG + Intergenic
1178412949 21:32380849-32380871 GGGCCCTGGAATGCTGGTCCAGG + Intronic
1179438825 21:41379512-41379534 GGGCCATGGAACCCCTCTCAAGG - Intronic
1179981674 21:44899199-44899221 GGTACCTGGAAGCCTTGTCCTGG - Intronic
1180149634 21:45940988-45941010 GGGCCCTGGAACCCCTGTCCCGG + Intronic
1180260748 21:46667353-46667375 GGGCGCTGGAACCCCAGCGCTGG - Intergenic
1180953894 22:19732809-19732831 GGCCTCAGCAACCCCTGTCCAGG + Intergenic
1181032513 22:20155235-20155257 GGGCCCTGGATCCCCGGCCCTGG + Intergenic
1181281847 22:21726197-21726219 GGGCCCTGCCAGCGCTGTCCAGG + Intronic
1181427229 22:22851561-22851583 AGTCCCTGGAACACCTGCCCAGG + Intronic
1181439437 22:22928144-22928166 GGGCACATGAACACCTGTCCTGG - Intergenic
1181510905 22:23388364-23388386 GGGCCCTGGATCCCCAGCCCTGG - Intergenic
1182299533 22:29329918-29329940 GGGCCCTGGAACAGCGGTGCAGG + Intronic
1182427061 22:30279502-30279524 TGGCTCTGGAACCCCAGTGCCGG + Intergenic
1183253252 22:36744751-36744773 GGGAGCTGGAACCCCTAGCCTGG - Intergenic
1183336103 22:37247537-37247559 GAGCCCTGGAACCACTCTCTGGG + Intergenic
1183706008 22:39475309-39475331 GGTCCCTGGAACTCCCCTCCAGG - Intronic
1183835140 22:40446399-40446421 TCGCCCTGGATCACCTGTCCAGG - Intronic
1183950101 22:41347951-41347973 GGTCCCTGCAAGCCCTGCCCTGG - Intronic
1185012059 22:48319788-48319810 GGGCCCAGGCACCCCTCTGCAGG - Intergenic
949388945 3:3537573-3537595 GGGCACCGGAGCCCCAGTCCTGG + Intergenic
950305481 3:11912844-11912866 GGGCACTGGTACCCCAGCCCAGG - Intergenic
953450221 3:42999381-42999403 GTGCCCAGCAACCTCTGTCCTGG + Intronic
953803495 3:46047891-46047913 CGTCCATGGACCCCCTGTCCTGG - Intergenic
954107505 3:48417372-48417394 GGGGCCTGCAACCGCTGGCCAGG + Intronic
954121832 3:48504208-48504230 GGTTCCCGGAACCTCTGTCCGGG + Exonic
954293983 3:49664072-49664094 GGGCCCTAAAGCCCCTGTGCTGG - Intronic
954327892 3:49873481-49873503 GGGCCCTGGTGCCACTGTGCTGG - Intergenic
954653793 3:52181678-52181700 GGCCCCTGAGTCCCCTGTCCTGG - Intergenic
954808130 3:53231993-53232015 TGACCCTGGAAGCCCTGTTCTGG - Intronic
955387716 3:58492373-58492395 GGGCCCCGGAACCCCCGCCCAGG - Intronic
956910114 3:73808119-73808141 GGGCCCTGTAACCCCTGTTTTGG + Intergenic
958882571 3:99689483-99689505 AGGCCCTGGAACCCATTTCTTGG + Intronic
960036679 3:113109293-113109315 GGGCCATGTGACCCCAGTCCTGG - Intergenic
961055245 3:123782161-123782183 GGGAACTAGAACCCCAGTCCAGG + Intronic
966902829 3:184499571-184499593 GGCCCCTGGTAACGCTGTCCAGG + Intronic
968645672 4:1739539-1739561 GGACCCTGGGAACCCTGTCGAGG - Intronic
968688478 4:1977106-1977128 GGGGCCCAGAGCCCCTGTCCTGG + Intronic
968737160 4:2303542-2303564 GGGCCATTGACCCCCTGGCCAGG - Intronic
969089871 4:4685658-4685680 CTGCCCTTGATCCCCTGTCCCGG - Intergenic
969423489 4:7110619-7110641 GGGCTCTGGAAGCCCTGGCGTGG - Intergenic
969514427 4:7638579-7638601 GGGACCCGGAACCCCTGGGCTGG + Intronic
971154119 4:24064082-24064104 GGGCCCTGGAAAGCCTCTTCTGG - Intergenic
975022119 4:69502696-69502718 GGCCCCTGGAGGCTCTGTCCAGG - Intronic
976820708 4:89203501-89203523 GGACCCTGGTAACCCTGGCCTGG - Intergenic
978161140 4:105549722-105549744 TGGCCATGTAACCCCGGTCCTGG - Intergenic
981048384 4:140286751-140286773 GGGCGCTGGAGCCGCTGTCAAGG + Intronic
984962522 4:185111496-185111518 GGGCTCTGGAACCCATGTCAAGG - Intergenic
985650590 5:1105484-1105506 GGGTCCTGGAGCCTCTGGCCGGG - Intronic
985813156 5:2105419-2105441 CGGCCCTGGGTCCCCTGCCCTGG + Intergenic
985891024 5:2715315-2715337 AGGCTCTGGAAACCCTTTCCTGG - Intergenic
986270194 5:6223502-6223524 GGTCCCAGGAAGCCCTCTCCAGG - Intergenic
991186635 5:63816013-63816035 GGGGCCTGTAACCTCTGTTCTGG + Intergenic
992609283 5:78493317-78493339 GGGCCCAGGAACTCCTGCCCAGG - Intronic
994077629 5:95671008-95671030 GGACCCTGGAACCTCTGACCTGG + Intronic
994346853 5:98697509-98697531 TGCCCCTGGAAACCCTGTTCTGG + Intergenic
1000398114 5:160797126-160797148 GGGCCCAGGAACCCCTGGCTGGG + Intronic
1000564808 5:162834495-162834517 GGGCCCTGTAACCCCTGTGTTGG - Intergenic
1001677128 5:173528247-173528269 TGGGCCTGGGGCCCCTGTCCTGG - Intergenic
1001774339 5:174317344-174317366 GGGCCCTGGGACCCCTCCCTGGG - Intergenic
1001810036 5:174620498-174620520 TGGCCTTGGAAACCATGTCCTGG - Intergenic
1002018529 5:176346385-176346407 AGGGCCTGGAACGCCTGTGCGGG - Exonic
1002173041 5:177385952-177385974 GGGCCCTGGGGCTCCTGACCAGG + Intronic
1002851814 6:1003460-1003482 GGGCCCTGGGACCCCTGCACAGG + Intergenic
1003080587 6:3017720-3017742 GTTCCCTGGAGCCCCTGACCTGG - Intronic
1005710178 6:28496745-28496767 GGGGCATGGAATCCCTATCCAGG + Intergenic
1006170520 6:32089282-32089304 GTGACCTGGTACTCCTGTCCAGG + Intronic
1006235375 6:32626294-32626316 GGGTCCTGGAACCAATCTCCTGG + Intergenic
1006911552 6:37566564-37566586 GGGGCCTGGAAGCCCAGCCCTGG + Intergenic
1006920534 6:37624721-37624743 TTGCCCTGGACACCCTGTCCTGG - Intergenic
1010956780 6:82099230-82099252 TGGCCTTGGAAATCCTGTCCAGG + Intergenic
1015197286 6:130537327-130537349 TGCCCCTGGAGGCCCTGTCCAGG - Intergenic
1016378696 6:143450722-143450744 GGGCCCGGGACCCCGTTTCCGGG + Intergenic
1017041585 6:150312747-150312769 GGGCCCTTGAACCCCTTGCTCGG + Intergenic
1017351627 6:153449247-153449269 GTGACCTGGAAGCCCTCTCCTGG - Intergenic
1018685084 6:166298050-166298072 GGGCCATGGGTCCCCTGTGCTGG - Intergenic
1018762429 6:166903840-166903862 GTGCCCTGGCACCTCTGACCTGG + Intronic
1018899771 6:168045263-168045285 GGGCCCTGAAGGCCCTGCCCCGG + Intergenic
1019493509 7:1325741-1325763 GGGCCCTGGTACCCACGCCCTGG - Intergenic
1020090120 7:5334020-5334042 GCACCTTGGAGCCCCTGTCCTGG - Intronic
1020091410 7:5344401-5344423 GGGCCCTGGTGCCTCTTTCCAGG + Intronic
1021847661 7:24778572-24778594 GGGCCCTGGAACCCAACACCTGG - Intergenic
1022110575 7:27228173-27228195 CAGCCCTGGAGCCCCTATCCAGG - Intergenic
1022525667 7:31035408-31035430 GGCTCCTGGATCCCATGTCCAGG - Intergenic
1023742498 7:43293291-43293313 GGGCCCTTGAACCGCTGCTCGGG - Intronic
1023998274 7:45175223-45175245 AGGCCCTGAAACACCTGTTCTGG + Intronic
1024301412 7:47890165-47890187 TGGCCCTGAAACCCCTGGCTGGG + Intronic
1025756820 7:64352022-64352044 GGCCCCTGGAGGCTCTGTCCAGG + Exonic
1025806538 7:64838631-64838653 GGGCCCCCAAACCCCTATCCAGG - Intergenic
1025994368 7:66518744-66518766 GGTCCCTGGAATCCCTCTCTGGG - Intergenic
1026033630 7:66815919-66815941 GGTCCCTGGAATCCCTCTCTGGG + Intergenic
1026873796 7:73868665-73868687 GCTCCCTGAATCCCCTGTCCTGG + Intergenic
1027224424 7:76235038-76235060 TGGCCCTGGAGCCGCTGGCCTGG - Exonic
1027798264 7:82720221-82720243 GGGCCCTGTAACCCCTTGCATGG - Intergenic
1031288867 7:119907669-119907691 GGGCCCTGTAACCCCTTTTTTGG - Intergenic
1033220559 7:139524144-139524166 TGGCCCAGGGACCCCTGCCCAGG + Intronic
1034227905 7:149497411-149497433 GGACCCCGGAACCCCTCCCCAGG + Intronic
1034397477 7:150838218-150838240 TGGCCCTGGCACTCCTGTGCTGG - Intronic
1034684027 7:152954068-152954090 GGGCCCTTGAGCCCCTATGCTGG - Intergenic
1034734067 7:153412625-153412647 GGGCCCCCAAACCCCTATCCAGG - Intergenic
1035132568 7:156669460-156669482 GTTCCCTGGAACCTCTGTCCAGG + Intronic
1035814997 8:2529468-2529490 GTGCCCTGGAAGCCCTGTGTGGG + Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1041535759 8:58923776-58923798 GGGACCCGGAACCCAGGTCCTGG - Intronic
1044486525 8:92761033-92761055 GGGAGCTGGAACACCTGTCTTGG - Intergenic
1044821106 8:96156507-96156529 GGGCCCTGGACCCCCAGCCCTGG - Intronic
1045429119 8:102096758-102096780 GGGCTCTTGAGCCCCTGTGCTGG + Intronic
1047051458 8:121117725-121117747 GGGCTCAGGAACTCCTGCCCTGG + Intergenic
1048877362 8:138847349-138847371 GGGCCCTTGAGCTCCTGCCCTGG + Intronic
1049460656 8:142726309-142726331 GAACCCTGGAACCCCAGCCCAGG + Intergenic
1051464506 9:17361959-17361981 GAGCCCTGGTACTCCTGACCAGG - Intronic
1052769003 9:32670484-32670506 GAGCCCTGTACCCCCTTTCCTGG + Intergenic
1053129468 9:35606871-35606893 GCTCCCCTGAACCCCTGTCCTGG + Exonic
1053168557 9:35861851-35861873 GGACACTGGAGCCCTTGTCCAGG - Intergenic
1056182876 9:84102514-84102536 GGGGACTGGCACCGCTGTCCAGG - Intergenic
1059534787 9:115070491-115070513 GGGCCCTGTAACCCATGGCTGGG + Intronic
1061212711 9:129203049-129203071 GGGCCCTAGGACCCCTCCCCTGG + Intergenic
1061887464 9:133599041-133599063 TGGCCCTTGCACCCCTGCCCTGG + Intergenic
1062540445 9:137039625-137039647 AGGCCCTGGGACCCCTTGCCAGG - Exonic
1062595884 9:137299006-137299028 GGGCCCTGGGGGCCCTGTACCGG - Intergenic
1203376661 Un_KI270442v1:382630-382652 GGGCCCAGGGCCCACTGTCCTGG - Intergenic
1189371364 X:40432014-40432036 GGGCCCTGTAACCCCTTTTTTGG + Intergenic
1191056335 X:56245196-56245218 GAGCACTGGAAACCCTGACCCGG - Intronic
1192926414 X:75759283-75759305 TGCCCCTGGAAACTCTGTCCAGG - Intergenic
1193789126 X:85797339-85797361 TGCCCCTGGAAGCTCTGTCCAGG + Intergenic
1195105724 X:101600096-101600118 TGGCTCTGGGAGCCCTGTCCCGG + Intergenic
1195107159 X:101613671-101613693 TGGCTCTGGGAGCCCTGTCCCGG - Intergenic
1200853456 Y:7910695-7910717 TGGTGCTGGAGCCCCTGTCCAGG - Intergenic
1200954296 Y:8929189-8929211 GGGCTCTGAACCCCCTGCCCTGG + Intergenic
1201770150 Y:17611225-17611247 GGGCCCCCAAACCCCTATCCAGG + Intergenic
1201831404 Y:18294762-18294784 GGGCCCCCAAACCCCTATCCAGG - Intergenic