ID: 1180149963

View in Genome Browser
Species Human (GRCh38)
Location 21:45942409-45942431
Sequence TGAACTCTGAGGAGCACAGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 302}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180149963_1180149968 10 Left 1180149963 21:45942409-45942431 CCCTCTGTGCTCCTCAGAGTTCA 0: 1
1: 0
2: 2
3: 36
4: 302
Right 1180149968 21:45942442-45942464 TGGCCCCTCCTCACCGGCTCTGG 0: 1
1: 0
2: 2
3: 22
4: 229
1180149963_1180149966 -10 Left 1180149963 21:45942409-45942431 CCCTCTGTGCTCCTCAGAGTTCA 0: 1
1: 0
2: 2
3: 36
4: 302
Right 1180149966 21:45942422-45942444 TCAGAGTTCAATAAATGTCGTGG 0: 1
1: 0
2: 0
3: 6
4: 213
1180149963_1180149967 4 Left 1180149963 21:45942409-45942431 CCCTCTGTGCTCCTCAGAGTTCA 0: 1
1: 0
2: 2
3: 36
4: 302
Right 1180149967 21:45942436-45942458 ATGTCGTGGCCCCTCCTCACCGG 0: 1
1: 0
2: 0
3: 10
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180149963 Original CRISPR TGAACTCTGAGGAGCACAGA GGG (reversed) Exonic
900090457 1:918024-918046 TGCCCTCTGGGGAGCACAGTGGG + Intergenic
900707447 1:4089528-4089550 GGGACTCTGAGTACCACAGATGG - Intergenic
902754186 1:18538195-18538217 TGAGCTCTCTGGAGCAGAGAAGG - Intergenic
903302330 1:22388262-22388284 AGCACTCTGAGGCACACAGAGGG + Intergenic
904569918 1:31455618-31455640 AGAACTCTGGGGAGCAGCGATGG + Intergenic
904978629 1:34477963-34477985 TGAGCCCAGAGGAACACAGAAGG - Intergenic
908102802 1:60808695-60808717 TGAACTTTGAGAACCACTGATGG + Intergenic
910149199 1:84121766-84121788 TGAAATCTGAGGGCCACAGCAGG - Intronic
911059361 1:93734503-93734525 TGACGTCTGAGGAGGTCAGATGG + Intronic
916026676 1:160839044-160839066 TGAATTCTGAGGAATACAGAAGG + Exonic
917216199 1:172680808-172680830 AGAAGTCTGGGAAGCACAGAGGG - Intergenic
918122501 1:181551661-181551683 TAGACTCTGAGGACAACAGAAGG + Intronic
919648279 1:200118825-200118847 TGAACTCTGTGGGGCACATTGGG - Intronic
919935019 1:202245602-202245624 TGAGCTCTGTGGGGCGCAGAGGG - Intronic
920123630 1:203676651-203676673 TGATCTGGGAGAAGCACAGAGGG - Intronic
920560410 1:206934550-206934572 TGAACTGTGACGAGAACAGCCGG - Exonic
922867244 1:228870563-228870585 TGATCCCTGTGGAGCAGAGATGG + Intergenic
923153724 1:231257600-231257622 TCAACTCTGAGAAGCACTTATGG - Intronic
923328108 1:232898471-232898493 TGGGCACTGAGGAGCACAGGAGG + Intergenic
923793466 1:237131192-237131214 TGAAGTCTGTGGAACACTGAAGG + Intronic
923891419 1:238219299-238219321 TGGTCTCTGAGGAGGACTGAGGG - Intergenic
924395886 1:243620149-243620171 TGAATTCTTAGGAGCTCTGATGG + Intronic
1062878630 10:960979-961001 AGAACACAGAGGAGCACAGCAGG + Intergenic
1063250140 10:4264868-4264890 TAAACCCTGAGGAGCTCAGGTGG + Intergenic
1063383086 10:5598771-5598793 TGAACTCTGGAGAGGGCAGATGG + Intergenic
1063442401 10:6083585-6083607 TGAACTCTGATGAGGACCCAGGG - Intergenic
1065221445 10:23500030-23500052 TGAAGTCTCAGGAGCCCAGGAGG - Intergenic
1066315430 10:34241375-34241397 TGAACACTGGGGAGCACCGGTGG + Intronic
1066443700 10:35462557-35462579 TGAACTTTCAGAAACACAGAGGG + Intronic
1066598817 10:37081691-37081713 TGAACCCTGAGTAGAACAAATGG + Intergenic
1067448343 10:46366743-46366765 TGCCCTCTGTGGGGCACAGATGG + Intergenic
1067589034 10:47494023-47494045 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1067636159 10:48002114-48002136 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1069778395 10:70940061-70940083 AGAACTCTGAGCGGCACACAAGG + Intergenic
1069861306 10:71473363-71473385 TGAACACACAGGTGCACAGAGGG - Intronic
1070132720 10:73666119-73666141 TGCCCTCTGTGGGGCACAGATGG - Intergenic
1070654852 10:78264336-78264358 TGAGCACTGGGGAGCACGGATGG + Intergenic
1071608964 10:87017955-87017977 TGCCCTCTGTGGGGCACAGATGG + Intergenic
1072391647 10:94993429-94993451 AGAACTCTGGGGAACAGAGATGG + Intergenic
1073096702 10:100984339-100984361 CTACCTCTGAGGAGCACCGATGG - Exonic
1073319891 10:102608804-102608826 TGGACTCTGAGGAGGACAGAGGG - Intronic
1074458605 10:113616512-113616534 TGAATTCTGAGAAACACAGATGG - Intronic
1076076443 10:127537488-127537510 TAATCTCTGAGAGGCACAGAAGG + Intergenic
1076273444 10:129176226-129176248 TGAACTCTCAGGAGCAAACGTGG + Intergenic
1077222920 11:1425382-1425404 TGGACTCTGGGGAGCTCAGTGGG - Intronic
1077450922 11:2645090-2645112 TGAGCTCTGAGCAGCAGATATGG + Intronic
1077972093 11:7205236-7205258 TGATCTCTGGGGAGGAGAGAGGG + Intergenic
1081725187 11:45322943-45322965 TGAACTCTTGAGACCACAGAGGG - Intergenic
1082254601 11:50019639-50019661 TATACTCTCAGAAGCACAGAGGG + Intergenic
1084322828 11:68383186-68383208 TGATTTCTTAGGAGGACAGAGGG + Intronic
1084840284 11:71840697-71840719 TGAACTCTTGGGACCCCAGATGG - Intergenic
1086137970 11:83461805-83461827 TGAACTCTCAGGAGAACCCAGGG + Intronic
1086554865 11:88097343-88097365 TAAACTCTTTGGTGCACAGATGG - Intergenic
1086579651 11:88384777-88384799 TGAAGTCTGTGGTACACAGAAGG - Intergenic
1086663525 11:89451784-89451806 TTACCTCCGAGGATCACAGAAGG - Exonic
1086987583 11:93267098-93267120 AGAACTCTGGAGAGCAGAGATGG - Intergenic
1087026335 11:93653517-93653539 TGAAGTCTTAGGAGCAAAGATGG + Intergenic
1088288041 11:108207512-108207534 TGAGCTCTGATGAGCACATGAGG - Intronic
1091119781 11:133047269-133047291 TGAACTCAGAGGAACACTCATGG - Intronic
1091339137 11:134796726-134796748 AGAGCTTTCAGGAGCACAGATGG - Intergenic
1093160371 12:15739830-15739852 AGAACTCTGACTAGTACAGAAGG + Intronic
1093193174 12:16098767-16098789 TTACCTTTGAGGAGGACAGAAGG + Intergenic
1094272326 12:28630475-28630497 TGCTCTCTGAGGTGCACTGATGG + Intergenic
1096049809 12:48597664-48597686 TGGACTCTCAGGAACACAGAAGG + Intergenic
1096050186 12:48600685-48600707 AGAACTCTGGGGAGCAGAGATGG - Intergenic
1097030773 12:56087804-56087826 ATTACACTGAGGAGCACAGATGG - Exonic
1097309242 12:58100470-58100492 GTGACTCTGAGGAGCACAGTGGG + Intergenic
1101553982 12:105789594-105789616 TGTTCTCTGAGAAGCACAGAGGG + Intergenic
1101659442 12:106752937-106752959 TGAGCTGAGACGAGCACAGAGGG - Intronic
1102432209 12:112892389-112892411 TGACCCCTGTGGAGCAGAGAAGG + Intronic
1102569165 12:113817081-113817103 TAGACGCTGCGGAGCACAGACGG + Exonic
1103281124 12:119758830-119758852 TGTACTCTGAGGATCACAGATGG + Intronic
1104387110 12:128360556-128360578 TCAACTCTAAGGAGCAAGGATGG - Intronic
1104546015 12:129713719-129713741 TGAACTCAGTGGAGACCAGAAGG - Intronic
1104961763 12:132491435-132491457 TGAACTCAGCTGAGCAGAGAAGG + Intronic
1106815779 13:33405303-33405325 TGCACGCTTAGCAGCACAGAGGG - Intergenic
1107682097 13:42862623-42862645 TGAAAACGGAGTAGCACAGAAGG + Intergenic
1107853405 13:44591956-44591978 TGGGCACTGAGGAGCACAGGAGG + Intergenic
1108416255 13:50200685-50200707 TGGACTCTGAGGAGCACTGGCGG + Intronic
1110008501 13:70302309-70302331 TGAACTCTCAGGAGAGCTGATGG - Intergenic
1111712773 13:91838253-91838275 TGAGTTCTGTGGAGCATAGAGGG - Intronic
1113411508 13:110094358-110094380 TGAACACAGATGGGCACAGAGGG + Intergenic
1113571213 13:111359552-111359574 TGACCTCTGAGGAGGGCACAGGG + Intergenic
1114551675 14:23536098-23536120 TGAAATCCGGGCAGCACAGAAGG + Intronic
1115397025 14:32919899-32919921 TCAGCTGTGAGGAGTACAGAGGG + Intergenic
1116019244 14:39441262-39441284 TGAGCACTGATGAGCTCAGAGGG + Intergenic
1118180044 14:63483553-63483575 TGAACTGGGAGGAGGAAAGAGGG + Intronic
1119931726 14:78554022-78554044 TGCACTCTGATGGGAACAGATGG + Intronic
1120374345 14:83681788-83681810 TTAAGTCTGAGGAGCAGAAAGGG + Intergenic
1120498375 14:85263375-85263397 TGCAAGCTGAGGAGCAAAGAGGG + Intergenic
1121110349 14:91308398-91308420 TGTGCTCTTAGAAGCACAGATGG - Exonic
1121774842 14:96583878-96583900 GGAAGACTGAGGACCACAGAAGG - Intergenic
1121993887 14:98586620-98586642 TGAATTCTGAGAAGAACAGTGGG - Intergenic
1122382835 14:101321950-101321972 AGAACTCTGGGGAGCAGAGATGG - Intergenic
1122505356 14:102228326-102228348 TGGTCACTGAGGAGCACACAGGG + Intronic
1126719799 15:51566474-51566496 TGCACTCTGAGGAACACTAAAGG - Intronic
1128112739 15:65086845-65086867 TGAACTCTGAGGAGAGCAGTGGG - Intergenic
1128488133 15:68117517-68117539 AGAACTCTGGGGAGGACAGAGGG - Intronic
1128598101 15:68972289-68972311 AGAACTCTGAGCAGTACACATGG - Intronic
1130098142 15:80871509-80871531 GGAAGTCTGAGGTCCACAGAAGG + Intronic
1130831286 15:87603508-87603530 GGAACTCTGAGGAACTGAGAAGG + Intergenic
1130899561 15:88196895-88196917 TGAACTCTAAAGAGCAAATATGG + Intronic
1131662803 15:94536750-94536772 TGAAGTCTGTGAATCACAGAAGG + Intergenic
1132091135 15:98948725-98948747 AGAACTCAGAAGAGCACGGAGGG - Intronic
1132104930 15:99056640-99056662 TGCCCCCTGAGGAGCACAGGAGG - Intergenic
1132657680 16:1048207-1048229 TGAACCCTGAGTAGCAAAGGTGG + Intergenic
1132758818 16:1499145-1499167 TGAACTCCGATGCCCACAGACGG - Intronic
1133960931 16:10492819-10492841 AGACCTCTGGGGAGCAGAGATGG - Intergenic
1135927272 16:26706633-26706655 TGAACTATGAAGAAGACAGATGG + Intergenic
1136454340 16:30371774-30371796 TGGAACATGAGGAGCACAGAGGG - Intronic
1136613249 16:31379990-31380012 TTTTCTCTGAGGAGCACCGAAGG - Exonic
1136701970 16:32152640-32152662 TGGACTCTGAGGAGGAAACAAGG + Intergenic
1136765695 16:32774820-32774842 TGGACTCTGAGGAGGAAACAAGG - Intergenic
1136802403 16:33095558-33095580 TGGACTCTGAGGAGGAAACAAGG + Intergenic
1138420092 16:56893172-56893194 TGAGCTCAGGGGAGCCCAGAGGG + Intronic
1139463726 16:67142686-67142708 TGCACTCTCAGGGGCCCAGAAGG - Intronic
1139877794 16:70160306-70160328 GGAACTCTGAAGAGCAAAAAGGG + Exonic
1140437264 16:74957866-74957888 AGAACTCTGAGGAGAGAAGATGG + Intronic
1203068084 16_KI270728v1_random:1037068-1037090 TGGACTCTGAGGAGGAAACAAGG - Intergenic
1143162344 17:4879795-4879817 GGAACTCAGAGAAACACAGAGGG - Intronic
1146176656 17:30669466-30669488 AGGACTCTGAGGAGCAGGGAGGG - Intergenic
1146442476 17:32909217-32909239 TCAACTCAGTGGAGCACAGTGGG + Intergenic
1146808593 17:35885279-35885301 TGGATTGTGAGGAGCACAGGAGG + Intergenic
1147410814 17:40250644-40250666 AGGTCTCTGAAGAGCACAGATGG + Intronic
1148908044 17:50923730-50923752 TGGATTCTGGGGAGCACAGCTGG - Intergenic
1149339339 17:55669809-55669831 AGAACTCTGAGGTGCGGAGAGGG - Intergenic
1149368226 17:55966854-55966876 TGAAATCTGAGGCCCAAAGAAGG - Intergenic
1149594785 17:57858399-57858421 TGCAATCTGTGGAGCACAGAAGG - Intergenic
1150750184 17:67854619-67854641 TGAAGTCTGTGTAGCACACAAGG + Exonic
1150864705 17:68837594-68837616 TGAACTCTGAGAAGTAGAGGGGG - Intergenic
1151188233 17:72379338-72379360 TGAACTCCCTGGAGGACAGAGGG - Intergenic
1151460310 17:74250288-74250310 TGGACTCTGAGGAGTTCAGCAGG - Exonic
1151556627 17:74850044-74850066 TGAGCTCTGAGGGCCCCAGAGGG - Intronic
1153473449 18:5471013-5471035 TGGACTCTGAGGAGTAGAAAGGG + Intronic
1154361038 18:13660881-13660903 TGTACAAAGAGGAGCACAGACGG + Intergenic
1155022215 18:21907002-21907024 GGAACCCTGAGGAGCTCACAGGG - Intergenic
1155255905 18:23997964-23997986 TGAAATGTGAGGAACAGAGAGGG + Intronic
1158012403 18:52743993-52744015 TGACAACTGAGGAGCACAGTAGG + Intronic
1158410337 18:57199557-57199579 GGAACTCTGGGGATCAGAGAGGG + Intergenic
1160057675 18:75499929-75499951 TGAGCTTTGGGGAGCACTGAGGG + Intergenic
1161618754 19:5287247-5287269 TGACCTTTGAGGGGCAGAGAAGG - Intronic
1162283581 19:9720259-9720281 AGAACTCTGGGGAGCAGAGATGG - Intergenic
1164478343 19:28592260-28592282 TGGACACTGAGGAGCAAAGTGGG - Intergenic
1164808894 19:31140641-31140663 TAAGCTTTGAAGAGCACAGATGG + Intergenic
1165447546 19:35864813-35864835 CCAACTCTGAGGACAACAGAAGG - Intronic
1166774548 19:45304454-45304476 TGAAGTCTGTGCAGTACAGAAGG + Intronic
1167209484 19:48124380-48124402 GGAGCTCTGAGGTACACAGAGGG - Intronic
1167951692 19:53032711-53032733 AGAACTTTGAGCAGCACAGCTGG + Intergenic
925697343 2:6594949-6594971 TGCTCTCTGAGGAACACTGAAGG - Intergenic
926681593 2:15668080-15668102 TGAACTCTCAGGAGCACTCAGGG + Intergenic
928108851 2:28490374-28490396 TGATCTTTGAAGAGCACAGAAGG - Intronic
928605779 2:32944396-32944418 TGAGCTCTCAGGAGATCAGATGG + Intergenic
928723673 2:34147873-34147895 TGGGCACTGAGGAGCACAGGAGG - Intergenic
930252645 2:49052765-49052787 TTAACTCTCAGAATCACAGAAGG + Intronic
930484647 2:51997147-51997169 TGAACTCTCATGAGTCCAGATGG + Intergenic
931718217 2:65046267-65046289 AGAACTCTGGGGAGCAGGGATGG + Intergenic
931898749 2:66764167-66764189 TGAAATCTGAGGAGGACACTAGG + Intergenic
932490802 2:72119013-72119035 TCAACTCTGAGGATCACAGCAGG + Intergenic
933214020 2:79605797-79605819 TGTACTCTGAGCTGCTCAGAAGG + Intronic
933772334 2:85752529-85752551 TGAACTCTGATGAAAACACAAGG - Intronic
935454593 2:103252585-103252607 TGAAGTCAGAGGAGCAGATAAGG - Intergenic
935575346 2:104703786-104703808 TGAATTCTCTGCAGCACAGAAGG + Intergenic
936378122 2:111960070-111960092 TTGACTCTGAGGACTACAGAAGG + Intronic
936685161 2:114819349-114819371 AGAAAACTGAGGATCACAGAGGG - Intronic
936716308 2:115191104-115191126 AGAACTCTGGGGAGCAGAGATGG + Intronic
937118735 2:119427598-119427620 AGAAAAGTGAGGAGCACAGAGGG + Intergenic
937698498 2:124836668-124836690 AGAACACTCAAGAGCACAGATGG - Intronic
937954247 2:127411019-127411041 TGATCTTTGAGGAGCCCATAAGG - Intergenic
938036782 2:128041319-128041341 AGAACTCTGGGGAGCAGAGATGG - Intergenic
938178339 2:129156784-129156806 TGGATTCTGGGGAGCACAAAAGG + Intergenic
940694330 2:156959684-156959706 TGGACACTGAGGAGCACAGGAGG - Intergenic
942513292 2:176725459-176725481 AGCACCCTGAGGAGCCCAGATGG - Intergenic
945483390 2:210367425-210367447 AGAACTCTGGGGAGCAGTGATGG + Intergenic
945900676 2:215534102-215534124 TGAGCTCGCAGGTGCACAGAAGG + Intergenic
946062661 2:216957534-216957556 TGAACTCAGAATAGCAGAGATGG - Intergenic
946711811 2:222514642-222514664 TCAACTCAGAGGATTACAGATGG + Intronic
948662046 2:239513683-239513705 TGGACACTGAGGTGCACTGATGG + Intergenic
1169404615 20:5313474-5313496 TGACTGGTGAGGAGCACAGAAGG + Intronic
1169599743 20:7244013-7244035 AGAACTCTGAGGAGCATACATGG - Intergenic
1170071309 20:12372120-12372142 TGTTCTCTGAGGAGCACAGCTGG + Intergenic
1170125872 20:12963549-12963571 TGAAATCTGCTGAACACAGAGGG - Intergenic
1170337709 20:15289008-15289030 TGAACTCTAAGGTGAACAGTTGG - Intronic
1171237489 20:23539377-23539399 TGTAGTCTGTGGAGGACAGAGGG + Intergenic
1172670695 20:36632798-36632820 AGAACTCTGAGGCCCAGAGAGGG - Intronic
1173047638 20:39528009-39528031 TGCCCTCTGTGGAGCACAGTAGG + Intergenic
1173407734 20:42781196-42781218 TGGAGTCTGAGGAGCTCACATGG - Intronic
1174441643 20:50560319-50560341 AGAAGTCTGAGGAGCATGGAAGG + Intronic
1175015541 20:55786131-55786153 GGAACCCTGAGGACAACAGATGG - Intergenic
1175415592 20:58798750-58798772 TGAACTCAGAGGGACTCAGAGGG - Intergenic
1175823404 20:61924005-61924027 AGGACGCTGAGGAGCAGAGAGGG - Intronic
1176366500 21:6036092-6036114 GGAACTCTGAGGAACATGGACGG - Intergenic
1177650710 21:23957700-23957722 TGAACGATGTGGAGCACAGAAGG + Intergenic
1178267185 21:31154421-31154443 TGTACTCTTCGGAGCACAGGGGG + Exonic
1178482722 21:32993661-32993683 TGCCCTCTGTGGAGCAGAGATGG - Intergenic
1178852883 21:36227881-36227903 TGTACTCTGAGGGGCAGAAATGG + Intronic
1178929430 21:36804658-36804680 TGCCCTTTGAGGACCACAGAGGG - Intronic
1179390307 21:40982946-40982968 TAATCTCTGAGGAGGAAAGAGGG - Intergenic
1179479535 21:41668728-41668750 TGCAGTCTGGGGATCACAGAAGG - Intergenic
1179511179 21:41874923-41874945 TGGGGTCTGATGAGCACAGACGG - Intronic
1179606951 21:42522856-42522878 AGAACACTGAGGAGCACACAAGG - Intronic
1179757017 21:43502453-43502475 GGAACTCTGAGGAACATGGACGG + Intergenic
1180149963 21:45942409-45942431 TGAACTCTGAGGAGCACAGAGGG - Exonic
1181367369 22:22388484-22388506 AGAACTTTGAGGAGCACACCTGG - Intergenic
1181777547 22:25170498-25170520 TGTACTGTGAGGAGGAGAGAGGG + Intronic
1181830071 22:25553526-25553548 TAGCCTCTGAGGAGCAGAGAGGG - Intergenic
1182145010 22:27992221-27992243 TTGACTCAGAGGGGCACAGAGGG - Intronic
1182150236 22:28022439-28022461 TGACCGCAGAGCAGCACAGAGGG - Intronic
1182283837 22:29232571-29232593 GGAACACTGAGGACCAGAGAGGG + Intronic
1182352038 22:29704571-29704593 TTAACTCTGAGCAGCACTGGGGG - Intergenic
1183265326 22:36821423-36821445 TGAATTCTCAGGAGCCCAGATGG + Intergenic
1183883610 22:40857361-40857383 AGAAATCCGCGGAGCACAGAGGG - Intronic
1184078375 22:42199224-42199246 GGAACCCTGACCAGCACAGATGG + Intronic
1184904790 22:47474047-47474069 AGAACTGAGAGGAGCACAGAGGG + Intronic
949609876 3:5693078-5693100 AGAACTCTGGGGAGCAGCGATGG + Intergenic
951334144 3:21400378-21400400 TGAATTATAAGTAGCACAGAAGG + Intergenic
953040429 3:39251042-39251064 GGAGCTCTGAGGAGCTCTGAGGG - Intergenic
955769192 3:62372303-62372325 TGGCCGCTGAGGAGCTCAGACGG + Exonic
956348523 3:68308163-68308185 TGAATTCAGAGGACCCCAGAAGG + Intronic
957165621 3:76669215-76669237 TGAAATCTGATGAGAAGAGAAGG + Intronic
957252232 3:77787834-77787856 TATACTCTGAGGAGAATAGAAGG + Intergenic
957861259 3:85954181-85954203 TGAAATCTGAGGAGAAAACACGG + Intronic
959939092 3:112061315-112061337 TGAAATCTGACGTGCACATAAGG - Intronic
960356157 3:116655949-116655971 TGAACTCTGAGAAGCAAAAAAGG - Intronic
962105289 3:132383124-132383146 TGGACTCTGATGAGCATAGGAGG - Intergenic
962249136 3:133824363-133824385 TTGGCTGTGAGGAGCACAGAGGG - Exonic
962262345 3:133920334-133920356 TCCAATCTGAGGACCACAGAGGG + Intergenic
963781784 3:149493793-149493815 AGAGCGCTGGGGAGCACAGAAGG + Intronic
964830844 3:160882750-160882772 TGACCTCTGAGGAGGACAACTGG - Intronic
968135794 3:196218490-196218512 TGAGCTCTCAGGTGGACAGATGG + Intronic
969079368 4:4606586-4606608 TGGACACTGAGAAGCACAGAGGG - Intergenic
969525661 4:7702709-7702731 TGAGCTCTGTGGGGCACAGAAGG + Intronic
969633408 4:8351471-8351493 TGAATTCTGAGGAGGAAAGGGGG - Intergenic
969669595 4:8582393-8582415 TGGAACCTGAGGAGGACAGAGGG - Intronic
969974691 4:11086605-11086627 TGAACTTTCAGAGGCACAGATGG - Intergenic
970529402 4:16966913-16966935 TGAACTCTTGGGAAGACAGAGGG + Intergenic
971139224 4:23905524-23905546 TGAACTTAGAGAAGCAGAGAAGG - Intergenic
971499496 4:27302946-27302968 TGAACTACAAGGAGCAGAGAAGG - Intergenic
972202468 4:36730809-36730831 TGCCAGCTGAGGAGCACAGATGG + Intergenic
975849820 4:78560651-78560673 AGACCTCTGAGGAGGAAAGAGGG - Intronic
976031539 4:80760688-80760710 TGAACTTTGAGGAAAAGAGATGG - Intronic
976710867 4:88070447-88070469 TGCACTCTGAGGAACAGAGAGGG - Intronic
977286830 4:95118088-95118110 TGAGCTCTGAGGATCTCAGGTGG + Intronic
977415470 4:96727337-96727359 TGAAGACTGAGGAGAACAGGTGG - Intergenic
977480852 4:97573439-97573461 TGAAATCTGAAGAGAAAAGAAGG + Intronic
980079581 4:128329862-128329884 TGACTTCTGAGAAGCACAGCAGG - Intergenic
986694324 5:10338708-10338730 AGAACTCTGACCAGTACAGAAGG + Intergenic
986738943 5:10689030-10689052 GCACCTCTGAGGAGCACCGAGGG - Intronic
987036796 5:14027248-14027270 AAAACTCTGGGAAGCACAGATGG + Intergenic
987153893 5:15068520-15068542 TGCAAGCTGAGGAGCAAAGAAGG + Intergenic
987390844 5:17374182-17374204 AGAGCTCTGAGGACCAGAGAAGG - Intergenic
987608888 5:20176115-20176137 TGTTTTCTGAGGAACACAGAAGG + Intronic
989216044 5:38905547-38905569 TGAAAAGAGAGGAGCACAGAGGG - Intronic
989408831 5:41093600-41093622 TGAACACTGAGGAGGAGAGCAGG + Intergenic
989800408 5:45531504-45531526 TGTATTCTGAGGACAACAGAGGG - Intronic
992864247 5:80941508-80941530 TAAACACTGAAAAGCACAGAGGG - Intergenic
993085084 5:83354060-83354082 TTAACTTTGAGTAGCACGGAAGG - Intergenic
993415951 5:87631249-87631271 TGACCTGTGAGGGCCACAGATGG + Intergenic
995648374 5:114339384-114339406 TGAGCTCTGAGCAGCAGACATGG + Intergenic
996316952 5:122170713-122170735 TGACCTCTGAGGAGGGAAGAGGG - Intronic
996832290 5:127753121-127753143 TGAACTGCGAGGAGCCAAGATGG - Intergenic
997341815 5:133151172-133151194 TTAACTGTGAGGACCACTGAAGG - Intergenic
997849202 5:137315799-137315821 TGAAGTCTGAGAAGCAGAGAGGG - Intronic
998539103 5:142962729-142962751 TGAACTGTGGGTAGAACAGAGGG + Intronic
998580660 5:143371912-143371934 TGAACACTAAGGAACAGAGATGG - Intronic
999246091 5:150155559-150155581 TGAAGGCTCAGGAGAACAGAGGG + Exonic
1001601992 5:172934996-172935018 TGAACTCTGCCGTGCACAGCTGG - Intronic
1001774283 5:174316919-174316941 TTAACACTGAGGGACACAGAAGG - Intergenic
1003438936 6:6121929-6121951 TGGGCACTGAGGAGCACAGGAGG + Intergenic
1005532837 6:26724668-26724690 TCTACTCTGAGGAGGTCAGATGG - Intergenic
1005535613 6:26753325-26753347 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1005537958 6:26776996-26777018 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1005601072 6:27426473-27426495 TGAACACTGTGAAGGACAGAAGG - Intergenic
1005895323 6:30172556-30172578 TGCACTCTGAGGTACAGAGAAGG - Exonic
1005986723 6:30880623-30880645 TGAATTCTCAGGGGCCCAGAAGG + Intronic
1006041679 6:31261280-31261302 TTACCTCTGAGAAGCAAAGAGGG + Intergenic
1007376793 6:41462478-41462500 TGAGCTCTGGGAAGCAGAGAAGG - Intergenic
1008127162 6:47681749-47681771 GGCACTCTGTGGAGAACAGATGG + Exonic
1009006653 6:57796953-57796975 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1009008820 6:57819362-57819384 TCTACTCTGAGGAGGTCAGATGG + Intergenic
1009448671 6:63775164-63775186 TGAACTCGGAGCAGGAGAGAAGG + Intronic
1011983020 6:93408624-93408646 TGAACTCTGAGCAAAACAAATGG - Intronic
1013613672 6:111820978-111821000 TTAACTCTGAGAAGCAGAGTGGG + Intronic
1015306568 6:131715519-131715541 GGAAATCTGTGGAGCAGAGAGGG - Intronic
1015703833 6:136065923-136065945 AGAACTCTGAAGATCACAGGGGG - Intronic
1015783256 6:136893530-136893552 TGAACTATGAGCCGCACAGGAGG + Intronic
1018065901 6:160124965-160124987 GGAACTCTGATGGGCAGAGATGG + Intronic
1018066632 6:160129118-160129140 TGGACTCTGGGGAGAACAGAGGG - Intronic
1021115144 7:16738921-16738943 TAAACTCTGGGGAGGAGAGAGGG + Intergenic
1021890591 7:25182288-25182310 TGAACACAGAGGAGCAGAAAAGG - Intergenic
1022917506 7:34972963-34972985 TGAATTCGGAGGATCACTGAAGG + Intronic
1023396915 7:39759976-39759998 AGAACTCTGGGGAGCAGGGATGG - Intergenic
1026524041 7:71139308-71139330 TGGACTCTGAGGAGAGGAGAGGG - Intronic
1028941004 7:96521979-96522001 TGAACTGTAAGGAGTACAGAGGG + Intronic
1032020092 7:128402790-128402812 TAAACTCAGAGAAGCCCAGATGG - Intronic
1033679826 7:143583460-143583482 GGAAATCTGTGGAGCAGAGAGGG - Intergenic
1033692008 7:143745983-143746005 GGAAATCTGTGGAGCAGAGAGGG + Intergenic
1033730981 7:144178981-144179003 GGAAATCTGTGGAGCAGAGAGGG + Intergenic
1033854665 7:145545051-145545073 TGTAGGCTGATGAGCACAGATGG - Intergenic
1034036199 7:147825348-147825370 TCAACTCTGAGTAGAGCAGAAGG - Intronic
1035788379 8:2280637-2280659 TGAACTCGGAGCAGCAGAGAGGG - Intergenic
1035804426 8:2441068-2441090 TGAACTCGGAGCAGCAGAGAGGG + Intergenic
1035815105 8:2530537-2530559 TGACCTCTGAGGAACCCTGAGGG + Intergenic
1038408855 8:27342683-27342705 TGGGATCAGAGGAGCACAGACGG - Intronic
1038831215 8:31062789-31062811 TTATCTCAGAGGGGCACAGAGGG - Intronic
1039037846 8:33378813-33378835 TGAAACCTGAGGAGCACAAAAGG + Intronic
1041963073 8:63642314-63642336 GGAATTCTGTGGAGCAGAGAGGG - Intergenic
1042027460 8:64439195-64439217 TGGGCCCTGAGGAGAACAGATGG + Intergenic
1042374814 8:68038344-68038366 TGAGTTCTGGGAAGCACAGAGGG - Intronic
1042380922 8:68113381-68113403 TGAACTCTGAATACCAAAGAGGG - Intronic
1042885127 8:73540835-73540857 AGAACTATAAGAAGCACAGATGG - Intronic
1043184594 8:77130802-77130824 TGAAATGTCAGGCGCACAGATGG - Intergenic
1044739723 8:95313825-95313847 TCAACACTGAGGAACAGAGAAGG - Intergenic
1047777914 8:128088890-128088912 TGAGCTCAGAGGAGGAGAGAGGG + Intergenic
1048535382 8:135289581-135289603 TGAGCTCTGAGGATTTCAGAAGG - Intergenic
1048649353 8:136457166-136457188 TAGACTCTGAGGATTACAGAAGG + Intergenic
1049100201 8:140573881-140573903 GGCAATCAGAGGAGCACAGAAGG - Intronic
1049178328 8:141207270-141207292 TGAACCCTGCGCAGGACAGAGGG + Intronic
1049366888 8:142243551-142243573 TGAACTCACAGAAGCAGAGAGGG + Intronic
1051996256 9:23221106-23221128 GGAACCCTCAGGAGCCCAGATGG - Intergenic
1054845431 9:69791523-69791545 TAAGCTCTGAAGAACACAGAAGG + Intergenic
1056077525 9:83056876-83056898 TGAATTCTGAGGGTCACAGCAGG + Intronic
1056277204 9:85004977-85004999 TGAGCTCTGAGAAACACTGAAGG + Intronic
1057444542 9:95104446-95104468 GGAACCCTCAGGAGCACAGAGGG - Intronic
1057865809 9:98679797-98679819 TGAAGACACAGGAGCACAGAGGG + Intronic
1058219224 9:102275864-102275886 TGAACTTAGAGGAACAGAGAGGG + Intergenic
1060171239 9:121463069-121463091 AGAACTTTGAGGAGAACTGAGGG + Intergenic
1060625958 9:125111725-125111747 TGATCTCTGAGGACAAAAGAAGG + Intronic
1061017931 9:127993424-127993446 TGAGATCTTAGGAGCACAGCTGG - Intergenic
1186798603 X:13070369-13070391 TGTTCTCTCAGGAGCACACACGG - Intergenic
1187520669 X:20011216-20011238 TCAAATCTGAGGAGGACAGATGG + Intronic
1187693441 X:21894705-21894727 TGAACCCTTAGGAGAATAGATGG - Intergenic
1188333746 X:28902449-28902471 TGAACTCTCAGGGGAACTGATGG - Intronic
1188693815 X:33163021-33163043 GGAACTCTGCAGTGCACAGAAGG + Intronic
1189111298 X:38292842-38292864 AGAATTCTGAGGGGCAGAGATGG + Intronic
1190633423 X:52411366-52411388 TGAACTCTGTGGAGCTGTGAGGG - Intergenic
1190747454 X:53332953-53332975 TGGACTCAGAGGAGCATGGAAGG + Intergenic
1191720928 X:64227916-64227938 TGGTCCCTGAAGAGCACAGATGG - Intronic
1194174670 X:90630900-90630922 TGCAAGCTGAGGAGCAAAGAAGG - Intergenic
1197366773 X:125573069-125573091 TTAAGTCTGTGGTGCACAGAGGG - Intergenic
1199505862 X:148560847-148560869 TGGACTTTGAGGAGAACAGGAGG - Intronic
1199596474 X:149509961-149509983 TGAACTCTGGAGAGTATAGATGG + Intronic