ID: 1180150311

View in Genome Browser
Species Human (GRCh38)
Location 21:45943898-45943920
Sequence AGATGAACACTTCAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180150299_1180150311 13 Left 1180150299 21:45943862-45943884 CCAGATGCGGAACACTTCAGGTG No data
Right 1180150311 21:45943898-45943920 AGATGAACACTTCAGGTGGGGGG No data
1180150296_1180150311 30 Left 1180150296 21:45943845-45943867 CCAGGTGGGGGAGCACTCCAGAT No data
Right 1180150311 21:45943898-45943920 AGATGAACACTTCAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180150311 Original CRISPR AGATGAACACTTCAGGTGGG GGG Intergenic
No off target data available for this crispr