ID: 1180150318

View in Genome Browser
Species Human (GRCh38)
Location 21:45943929-45943951
Sequence AGATGAACACTTCAGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180150308_1180150318 10 Left 1180150308 21:45943896-45943918 CCAGATGAACACTTCAGGTGGGG No data
Right 1180150318 21:45943929-45943951 AGATGAACACTTCAGGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180150318 Original CRISPR AGATGAACACTTCAGGTGGG GGG Intergenic
No off target data available for this crispr