ID: 1180155102

View in Genome Browser
Species Human (GRCh38)
Location 21:45973813-45973835
Sequence TGAGTTTCACACTCAGTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180155098_1180155102 -9 Left 1180155098 21:45973799-45973821 CCTCAGCGAGCTCCTGAGTTTCA No data
Right 1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG No data
1180155097_1180155102 -1 Left 1180155097 21:45973791-45973813 CCAGGGGGCCTCAGCGAGCTCCT No data
Right 1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG No data
1180155089_1180155102 24 Left 1180155089 21:45973766-45973788 CCAATGCACGCGGCCCCGGGAAG No data
Right 1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG No data
1180155095_1180155102 10 Left 1180155095 21:45973780-45973802 CCCGGGAAGCACCAGGGGGCCTC No data
Right 1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG No data
1180155094_1180155102 11 Left 1180155094 21:45973779-45973801 CCCCGGGAAGCACCAGGGGGCCT No data
Right 1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG No data
1180155096_1180155102 9 Left 1180155096 21:45973781-45973803 CCGGGAAGCACCAGGGGGCCTCA No data
Right 1180155102 21:45973813-45973835 TGAGTTTCACACTCAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180155102 Original CRISPR TGAGTTTCACACTCAGTGCG GGG Intergenic
No off target data available for this crispr