ID: 1180155385

View in Genome Browser
Species Human (GRCh38)
Location 21:45974874-45974896
Sequence GAGTCATGTTCTAAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180155373_1180155385 24 Left 1180155373 21:45974827-45974849 CCGCGGAAACCGCATGTGTAACC 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1180155378_1180155385 3 Left 1180155378 21:45974848-45974870 CCCCTGGAAACAGGGTCCTCCTT 0: 1
1: 0
2: 2
3: 20
4: 190
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1180155375_1180155385 15 Left 1180155375 21:45974836-45974858 CCGCATGTGTAACCCCTGGAAAC 0: 1
1: 0
2: 3
3: 19
4: 192
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1180155371_1180155385 30 Left 1180155371 21:45974821-45974843 CCACCACCGCGGAAACCGCATGT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1180155380_1180155385 1 Left 1180155380 21:45974850-45974872 CCTGGAAACAGGGTCCTCCTTGA 0: 1
1: 0
2: 1
3: 15
4: 142
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1180155372_1180155385 27 Left 1180155372 21:45974824-45974846 CCACCGCGGAAACCGCATGTGTA 0: 1
1: 0
2: 0
3: 0
4: 16
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82
1180155379_1180155385 2 Left 1180155379 21:45974849-45974871 CCCTGGAAACAGGGTCCTCCTTG 0: 1
1: 0
2: 1
3: 20
4: 230
Right 1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180155385 Original CRISPR GAGTCATGTTCTAAGTTGGG AGG Intergenic
902256217 1:15190412-15190434 GTGTCAGGTTCCAAATTGGGAGG - Intronic
909587845 1:77311186-77311208 AAGGAATGTTCTAAGTTGGCAGG - Intronic
916409224 1:164528729-164528751 GAGTCAGTTTCTGAGTGGGGGGG + Intergenic
923123149 1:231012739-231012761 GAGTCTTGCTCAAATTTGGGAGG - Intergenic
923166778 1:231372015-231372037 AAGACATGTTCTCAGTTTGGAGG - Intronic
924277362 1:242401956-242401978 GAGTCATGTTCTAAGGTCAAAGG + Intronic
924381087 1:243465170-243465192 GAGTCATGGTCTCTTTTGGGAGG + Intronic
1068359698 10:55960994-55961016 TAGTCATGTTCTTATTTTGGTGG + Intergenic
1068678322 10:59791250-59791272 GAGTGATGTTCTCAGTTTGGGGG + Exonic
1069251875 10:66277873-66277895 GAGACATGTTCTCAGTTGCATGG + Intronic
1069794342 10:71042725-71042747 GGGTCAAGTTCTAAAGTGGGGGG - Intergenic
1071069263 10:81672016-81672038 GTGTCATTTTCTGAGTTGAGTGG + Intergenic
1079448692 11:20580606-20580628 TGGTTATGTGCTAAGTTGGGAGG + Intergenic
1079882119 11:25941538-25941560 AGGTCATGTTCTAAGTTGAGAGG - Intergenic
1093433500 12:19109583-19109605 GATTCATGTTTGAAGTTGGGAGG - Intergenic
1094480382 12:30876669-30876691 GAGCCTTGTGCTAAGGTGGGGGG + Intergenic
1095307803 12:40658907-40658929 GAGTAATTTTATTAGTTGGGAGG - Intergenic
1096683425 12:53272189-53272211 GAGCCACGTTCTAGTTTGGGGGG + Intronic
1102168178 12:110822456-110822478 GGGGCCTGTTCTGAGTTGGGAGG + Intergenic
1102172370 12:110852160-110852182 GACTCCTGCTCTAAGATGGGAGG + Intronic
1107584806 13:41833548-41833570 TCGTCATGTTCTTTGTTGGGTGG - Intronic
1109941889 13:69378952-69378974 GAGTAATGTTCTAAATTTGTGGG - Intergenic
1112201205 13:97277158-97277180 GAGTCATATACTGAGTTGGGTGG + Intronic
1116545061 14:46155019-46155041 GAGAGATTTTCTGAGTTGGGAGG + Intergenic
1117951958 14:61091667-61091689 AAGTCATTTTCTACTTTGGGTGG + Intergenic
1118767420 14:68919252-68919274 GAGTCATGTCCTAAGCGGGATGG - Intronic
1120033396 14:79668147-79668169 TTTTCACGTTCTAAGTTGGGTGG - Intronic
1121878176 14:97474029-97474051 TTGTCATGTTCTATGTTGTGAGG - Intergenic
1127506127 15:59599616-59599638 GAGTCAGTTTCTGAGCTGGGGGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1135077692 16:19408350-19408372 GAGTCAAAGTCAAAGTTGGGAGG - Intergenic
1145352264 17:22093029-22093051 AAGTCATGTGATTAGTTGGGTGG + Intergenic
1152236721 17:79142838-79142860 GAGCCATGTTCAAGGATGGGGGG + Intronic
1158910471 18:62056488-62056510 GAGTCATCTGCTGAGATGGGAGG - Intronic
927540055 2:23901099-23901121 GACTCATGTTTCCAGTTGGGTGG - Intronic
936978415 2:118241788-118241810 GAGACTTGTTCCAGGTTGGGAGG - Intergenic
945645327 2:212484908-212484930 GAGTCATGTTCTAAGAGTTGTGG - Intronic
1169893535 20:10478395-10478417 GAGTAATTTGCTCAGTTGGGAGG + Intronic
1169974616 20:11310685-11310707 AAGTCATGTTACAAGTTGTGTGG + Intergenic
1172352841 20:34256731-34256753 GAGGCATGTTATAAATTAGGAGG - Intronic
1172902541 20:38345647-38345669 GAGTAAGGTTCTATTTTGGGGGG - Intergenic
1176978058 21:15346747-15346769 CAGTCATGTTCTAAGCTTGAGGG + Intergenic
1179130495 21:38632042-38632064 GAGCCATGTTACAAGATGGGAGG - Intronic
1180155385 21:45974874-45974896 GAGTCATGTTCTAAGTTGGGAGG + Intergenic
952126687 3:30309038-30309060 GAGTCATGTTCTAAGGTACAAGG + Intergenic
952292362 3:32029999-32030021 GAGTCATGTTTGAAACTGGGTGG - Intronic
953545030 3:43858056-43858078 GCATAATGTTCTAACTTGGGGGG + Intergenic
955985686 3:64572133-64572155 GAGTCTTGCTCAAAGTTGGGAGG - Intronic
956183308 3:66537824-66537846 AACTCTTGTTCTAATTTGGGAGG + Intergenic
956263657 3:67373645-67373667 GAGTCATATTCAATTTTGGGAGG + Intronic
957214971 3:77308249-77308271 TAGTCATGTTCTATGTAGGCAGG + Intronic
957588043 3:82158171-82158193 GAGTCAGTTTCTGGGTTGGGGGG - Intergenic
960170613 3:114456062-114456084 GAGTAATCTTCTTATTTGGGAGG - Intronic
962450665 3:135513893-135513915 GAGTCATTTCCTGGGTTGGGGGG - Intergenic
964204046 3:154151159-154151181 GAGGTATGTTTCAAGTTGGGTGG - Intronic
965441437 3:168720134-168720156 GAGCCATGTTCTAAGGAGGAGGG - Intergenic
971825176 4:31611950-31611972 GAGTCATGTCCTAGGGAGGGAGG - Intergenic
973540491 4:51930488-51930510 AAGGCATGTTCAAAGTTGGGTGG - Intergenic
976560656 4:86496801-86496823 GAGTAATGTTTTTTGTTGGGTGG - Intronic
977744650 4:100531632-100531654 GAGTGATTTTCTAAGTGTGGCGG + Intronic
985707428 5:1409578-1409600 GAGTCATTTTCTGGGGTGGGTGG + Intronic
994164897 5:96598303-96598325 GGGTCCTGTTCTAATTTGGCTGG - Intronic
995434114 5:112116394-112116416 GACTCTTGTTCTAAGTTGAATGG + Intergenic
999174350 5:149621329-149621351 GTGGCATGTGCTAAGGTGGGAGG + Intronic
1002971161 6:2021732-2021754 GAGTCATTTCCACAGTTGGGTGG - Intronic
1003807182 6:9738240-9738262 TAGTCCTGTTCTACTTTGGGTGG - Intronic
1003940206 6:11016982-11017004 GAGTAATGAGCTAAGTTGGAGGG + Intronic
1015189225 6:130455248-130455270 GACTCATTTTCTAGGGTGGGGGG - Intergenic
1016310998 6:142733566-142733588 GAGTAAGGTTCTATGTGGGGAGG - Intergenic
1018768382 6:166951936-166951958 GGGTCATGTTCACAGATGGGAGG - Intronic
1023754786 7:43406498-43406520 CAGTCATGGTTTAAGTTGTGAGG - Intronic
1030432401 7:109467243-109467265 GAATCAGGTTCTAAGTTGGCTGG + Intergenic
1032341897 7:131081716-131081738 GAATCATGCTTGAAGTTGGGAGG + Intergenic
1038091706 8:24261661-24261683 CAGTCATGTTAACAGTTGGGAGG - Intergenic
1039570532 8:38582743-38582765 GAGCCATGGTCTGAGCTGGGAGG - Intergenic
1044446580 8:92284259-92284281 GAGTCATGTCCTAAATTCTGTGG - Intergenic
1045690849 8:104758381-104758403 GAGTCAGTTCCTGAGTTGGGGGG + Intronic
1045748224 8:105449997-105450019 GAATCATGTTTTAAGTCGGGTGG - Intronic
1049584906 8:143428601-143428623 GAGTCCTGTGCTCAGTCGGGTGG - Exonic
1049789134 8:144465142-144465164 GACTCAGGGTCTAAGCTGGGGGG + Intronic
1049807884 8:144549110-144549132 GACTCATGCACTGAGTTGGGAGG - Intronic
1052466117 9:28831485-28831507 GAGTCATGTTCTTGGTTAGTAGG + Intergenic
1052692873 9:31837266-31837288 GAGTCCTGTTAGAAGTTGAGGGG - Intergenic
1053097515 9:35341444-35341466 GAGACAAGCTCTAAGTTGGTTGG - Intronic
1055761551 9:79614214-79614236 GTGTCATGTTCTAAGGTGACAGG + Intronic
1057308449 9:93926144-93926166 GAGTCATGATCTGAGTGGGCTGG - Intergenic
1059652989 9:116333021-116333043 GAGTCAGGTTCTACCATGGGAGG + Intronic
1059811765 9:117862907-117862929 GAGGCCTGTACTAAGGTGGGTGG - Intergenic
1060452616 9:123757086-123757108 AAGGCATGTTCTGAGGTGGGAGG - Intronic
1190973854 X:55379941-55379963 GATTCATATTCTAACTTTGGGGG - Intergenic
1193084907 X:77440196-77440218 GAGTCAAGTGCTAAATTGTGTGG - Intergenic