ID: 1180157234

View in Genome Browser
Species Human (GRCh38)
Location 21:45983584-45983606
Sequence CCGTGCCCAGCAGGAGCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180157228_1180157234 -9 Left 1180157228 21:45983570-45983592 CCTTCCAGCCCACACCGTGCCCA 0: 1
1: 0
2: 2
3: 34
4: 347
Right 1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG 0: 1
1: 0
2: 0
3: 24
4: 196
1180157227_1180157234 10 Left 1180157227 21:45983551-45983573 CCGGTAACAGCAGGGTGGACCTT 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG 0: 1
1: 0
2: 0
3: 24
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180157234 Original CRISPR CCGTGCCCAGCAGGAGCCAT TGG Intronic
900264435 1:1750262-1750284 CCAGACCCCGCAGGAGCCATGGG + Intergenic
900590177 1:3455963-3455985 CTGTCCAGAGCAGGAGCCATGGG + Intronic
901206949 1:7502925-7502947 CTGTGCCCAGGGTGAGCCATGGG - Intronic
901271288 1:7953982-7954004 CTGGGCCCAGCAGGTGCCAAGGG + Intergenic
902393345 1:16118961-16118983 CCGGGCCCAGCAGGAGAAAGGGG + Intergenic
902642403 1:17775252-17775274 CCCTGCCCAGCTGGACCCCTGGG - Intronic
903874539 1:26464481-26464503 CCTTCTCCAGCAGGAGCCCTTGG + Intronic
905182271 1:36174846-36174868 CCGGGCCCGGCAGGAGCCAGTGG - Intronic
912470831 1:109905711-109905733 AAGTGCCCAGCAGCAGCCAATGG + Intergenic
914349400 1:146827117-146827139 CCCTGCCCAGCAGGAATGATGGG + Intergenic
916199240 1:162254419-162254441 CCCTCCCCAGCAGGGGCCAGTGG + Intronic
919830962 1:201539793-201539815 CCCATCCCAGCAGGAGCCAGAGG + Intergenic
920982740 1:210853531-210853553 ACTTGCCCACCAGGAGCCCTGGG - Intronic
922482890 1:225951219-225951241 CTGTGCCCAGCAGGGGACCTAGG - Intergenic
922827005 1:228528970-228528992 CTGTGCCCACCAGTAGCCACTGG + Intergenic
923791100 1:237111965-237111987 CCATGCCCAGCAGCTGTCATTGG + Intronic
1063535347 10:6877440-6877462 CCGTGCACAGCAGGTGTCAGAGG - Intergenic
1064060074 10:12129770-12129792 GCCTCCCCAGCAGCAGCCATGGG + Exonic
1065615328 10:27515576-27515598 CTGTGCCCAGCAGAAGTCATAGG - Intronic
1067053423 10:43038139-43038161 CCGAGCCCAGCCCGAGCCACAGG + Intergenic
1067728306 10:48790363-48790385 CCCTGCCCAGCAGGATCTAGAGG + Intronic
1069817290 10:71206495-71206517 CCGAGGGCAGCAGGAGCCAAGGG - Intergenic
1071630715 10:87216410-87216432 CCAGGGCCTGCAGGAGCCATGGG - Intergenic
1073070760 10:100791809-100791831 GAGTGCCCAGCATGAGCCCTTGG + Intronic
1073365205 10:102934569-102934591 CCGCGCCCAGCCTGAGCCACCGG + Intronic
1075456319 10:122587258-122587280 CCCTTCCCAGCATGAGCCCTTGG - Intronic
1075647681 10:124107393-124107415 CAGTGCCCAGCAGGGGTCAGAGG + Intergenic
1076413338 10:130267113-130267135 CAGTGCCCAGCGGGAGCCTCAGG - Intergenic
1076462796 10:130657792-130657814 CCGTTCACTGCAGGAGCCACGGG - Intergenic
1076916509 10:133425066-133425088 GCCAGCCCAGGAGGAGCCATGGG - Intergenic
1076936614 10:133569861-133569883 GCCAGCCCAGAAGGAGCCATGGG - Intergenic
1077100245 11:819365-819387 CCGTGCCCAGCAGGGGCGGAGGG + Intronic
1078086303 11:8234710-8234732 CAGTGCCAAGCAGGAGACACTGG - Intronic
1078762118 11:14259814-14259836 CAGTGCCCAGCAAGGACCATGGG - Intronic
1078978468 11:16504828-16504850 CCATGGCCAGCAGGAGCCAGTGG - Intronic
1083500453 11:63102436-63102458 CCCATCTCAGCAGGAGCCATAGG + Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1084274160 11:68043274-68043296 CCCTGCCCAGCACGGGCAATCGG - Intronic
1084592436 11:70098429-70098451 CCGTGTCAGGCAGGAACCATGGG - Intronic
1085173956 11:74470739-74470761 CCGGGCCTAGCATGAGGCATAGG + Intergenic
1085350730 11:75796546-75796568 CAGTGCCCAGCAGGAGCACAGGG - Intronic
1085980237 11:81715806-81715828 CCATGCCCAGCAGGATCCAAAGG - Intergenic
1087105028 11:94400144-94400166 CAGTGCCCAGCCGTACCCATGGG - Intronic
1094372376 12:29751863-29751885 CCATGCACAACAGGAGCAATGGG - Exonic
1094457952 12:30659559-30659581 CCGTGCCCAGCCGTAGCTGTTGG - Intronic
1103003421 12:117403419-117403441 CTGTGCCCAGCAGGAGCAGTCGG + Intronic
1103727497 12:123005316-123005338 CGGAGCCCAGCAGCAGCAATGGG - Exonic
1106049873 13:26180042-26180064 CCAGGTACAGCAGGAGCCATTGG + Intronic
1106199696 13:27526076-27526098 CCATGCCCATCAGGAGCCAGGGG - Intergenic
1107254214 13:38404027-38404049 TGATGCTCAGCAGGAGCCATCGG + Intergenic
1108027875 13:46197405-46197427 CCGGTCCCAGTAGGTGCCATTGG + Intronic
1110118148 13:71845941-71845963 CTGTTCCCAGCAGGCCCCATAGG - Intronic
1112159092 13:96849671-96849693 CAGTGCCCAACATAAGCCATTGG + Intergenic
1112919011 13:104587373-104587395 AAGTTCCCAGCAGGAGCCTTGGG + Intergenic
1113636899 13:111925637-111925659 CTGTGCCCAGGAGGAGGCCTGGG + Intergenic
1113665052 13:112135780-112135802 CCGTCCCCGGCAGGGGCCCTAGG - Intergenic
1113680881 13:112244265-112244287 CGGTGGCCAGCAGGAGACTTCGG - Intergenic
1114522328 14:23347299-23347321 GCCTGCCCAGCTAGAGCCATGGG - Intronic
1114662769 14:24358607-24358629 TGATGCCCAGAAGGAGCCATGGG + Intergenic
1118452218 14:65913355-65913377 CCTTTCCCAGCACCAGCCATGGG + Intergenic
1119647136 14:76356027-76356049 CAATGCCCAGAGGGAGCCATGGG + Intronic
1121336926 14:93083293-93083315 CCATGACCAGCAGCAGGCATGGG + Intronic
1122697464 14:103562969-103562991 CCGTGCGCCGCGGGAGCCAGGGG + Exonic
1122814060 14:104303701-104303723 CAGGGCCCAGCAGGATCCAGAGG - Intergenic
1122896759 14:104761534-104761556 CAGTCCTCAGCAGGAGCCTTAGG - Intronic
1125609978 15:40963418-40963440 CTGTGCCCAGCAGGTGTTATTGG + Intergenic
1126010063 15:44294285-44294307 CCGTGCCCAGCTGCAGACCTTGG - Intronic
1126111767 15:45179405-45179427 CCCTGCCCTCCAGGAGCCACAGG - Intronic
1127259899 15:57319917-57319939 CCGAGCCCAGCTGGAGGCAGAGG - Intergenic
1127739943 15:61893297-61893319 CCATGCCCTGCAGGAGGCAGTGG + Intronic
1128378561 15:67094370-67094392 CCCTGCTCAGGAGGAGCCACGGG - Intronic
1128911962 15:71523675-71523697 ACGACCACAGCAGGAGCCATGGG + Intronic
1131061168 15:89405593-89405615 ACCTGCCAAGCAGGAGCCCTGGG - Intergenic
1132336070 15:101049511-101049533 CTGTGCCCTGCAGGACCGATGGG - Intronic
1132387125 15:101408528-101408550 CCAGGCTAAGCAGGAGCCATAGG - Intronic
1132860640 16:2070031-2070053 CCGAGGCCAGCAGGAGCCAGGGG - Intronic
1133258457 16:4533322-4533344 CCCTGCCCTGCAGGAGCTATGGG - Intronic
1133569308 16:7025725-7025747 CCTAGCTGAGCAGGAGCCATGGG + Intronic
1135490424 16:22904712-22904734 CAGAGCCCAGGAGGGGCCATGGG + Intronic
1135526255 16:23215631-23215653 GCATGCGCAGGAGGAGCCATCGG + Exonic
1136269251 16:29138868-29138890 GTGGGCCCAGGAGGAGCCATTGG - Intergenic
1136590925 16:31217158-31217180 CCCCTCCCAGCAGGAGCCACAGG - Exonic
1139521282 16:67483968-67483990 CCCTGCCCAACAGTGGCCATTGG - Intergenic
1139676998 16:68530468-68530490 CCCTGCCCAGCAGCAGTCAGCGG + Intronic
1139984636 16:70888437-70888459 CCCTGCCCAGCAGGAATGATGGG - Intronic
1141176744 16:81725395-81725417 CCCTGCCCAGCAGTAGCCAGTGG - Intergenic
1141294727 16:82757032-82757054 ACTTGCCCATCAGGATCCATGGG + Intronic
1142072734 16:88100140-88100162 GTGGGCCCAGGAGGAGCCATCGG - Intronic
1142552066 17:747023-747045 CCGTGCTCCGCAGCAGCCAGGGG - Exonic
1142673148 17:1496791-1496813 CCGTGTCTAGCTGAAGCCATTGG - Exonic
1142709350 17:1715142-1715164 CTGTGCCAAGCAGGTGCCCTTGG + Intergenic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143858983 17:9874179-9874201 GCGTACCCACCAGGAGCCATTGG + Intronic
1143870773 17:9956122-9956144 CCTGGCCCAGCAGGAGCCTGTGG + Intronic
1144454140 17:15405087-15405109 CCATGCCCAGGAGGTGCGATGGG - Intergenic
1144583526 17:16473842-16473864 CCTTGCCCAGCAGGAGTCAGCGG + Intronic
1145264606 17:21373803-21373825 CGCTGCCCAGCAGGAGACCTGGG - Intergenic
1146296589 17:31655022-31655044 CAGGGCCCAGCAGCAGCCAGGGG + Intergenic
1147140622 17:38458733-38458755 CTGTGGCCAGCAGGGGCCAGGGG - Intronic
1147331140 17:39700195-39700217 CCGGGTCCAGCCGGAGCCATGGG + Exonic
1147430420 17:40367208-40367230 CCTGACCCAGCAGGAGCCACGGG - Intergenic
1148340210 17:46868882-46868904 ACCTTCCCAGCAGAAGCCATGGG + Intronic
1152352931 17:79793400-79793422 CCGTGCCCGGCCGGAGCCGCGGG + Exonic
1152758050 17:82095270-82095292 ACGTGAGCAGCAGGAGCCCTCGG + Intronic
1152904436 17:82962576-82962598 CCGTGCCCACCAGCACCCACAGG - Intronic
1153227207 18:2907985-2908007 CCGTGGGCATCAGGGGCCATGGG - Intronic
1158535975 18:58308811-58308833 CAGTGCCCATCAGGAGGGATGGG - Intronic
1160979032 19:1807967-1807989 CCCTGCCCAGCAGGAACCAGCGG + Intronic
1162123639 19:8487460-8487482 CACAGCCCAGCAGGTGCCATGGG + Intronic
1162322361 19:9977655-9977677 TTGGGCCCAGCAGGAGGCATTGG - Exonic
1163366426 19:16878378-16878400 CCGGGCCAAGCAGGTGCCAGGGG + Exonic
1163501406 19:17678691-17678713 ATGTGCCCAGCAGGAGCTTTGGG + Intronic
1164072173 19:21778200-21778222 CAGGGACCAGCAGCAGCCATGGG + Intergenic
1165040472 19:33064706-33064728 CCGGGCCCTGCAGGGGCCGTGGG - Intronic
1165495005 19:36147474-36147496 CCGTGCCCAGCCGAGGCCAAGGG - Intronic
1167159072 19:47755881-47755903 CCGTGCCCCCCAGGGGCTATGGG + Intronic
1167260007 19:48452962-48452984 CCGTGCTGACCAGGAGCCCTGGG - Exonic
1167688861 19:50973105-50973127 CCTTGCCCAGAAGAAGCCTTAGG + Intergenic
1167735752 19:51293705-51293727 CAGTTCCCAGAAGGAGCCCTGGG - Intergenic
926113357 2:10196400-10196422 CAGAGACCAGCAGGAGCCCTGGG + Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
927882341 2:26697621-26697643 CTGTGCCCAGCACCCGCCATGGG + Intronic
929273300 2:39998112-39998134 CCGGGCACAGGAGCAGCCATGGG + Intergenic
929931464 2:46259484-46259506 CCCTGAACAGGAGGAGCCATGGG + Intergenic
931249541 2:60517621-60517643 CCATGGCCAGCAGGAGCCAGAGG - Intronic
934853275 2:97714249-97714271 CAGGGCCCAGCAGGAGCCCAGGG - Intronic
935091665 2:99900630-99900652 CAGTGCCCAGCAGGACACAGTGG + Intronic
947592253 2:231392613-231392635 CGGAGCCCAGCAGGGGCCACGGG - Intergenic
948424198 2:237877369-237877391 TCCTGCCCACCAGGGGCCATGGG - Intronic
948789047 2:240367861-240367883 CCGTGCCCAGCAGGATCCTCTGG - Intergenic
1172879546 20:38190590-38190612 CCCTGACCAGCAGGACCGATGGG - Intergenic
1172997702 20:39083349-39083371 CCCTGCAGAGCAGGAGCCAGAGG + Intergenic
1175481325 20:59313309-59313331 CCTTGTCCAGCCGGAGCCACTGG - Intronic
1176142219 20:63549813-63549835 CCATGCCCAGCTGGAACCAGAGG + Intronic
1178497732 21:33101478-33101500 CGGGGCGCAGCGGGAGCCATGGG - Intergenic
1178945946 21:36947779-36947801 CCCTGCCCAACAGGGGGCATTGG + Exonic
1179888531 21:44324766-44324788 CCGGGGCCAGCAGGAGCACTGGG - Intronic
1180157234 21:45983584-45983606 CCGTGCCCAGCAGGAGCCATTGG + Intronic
1181361974 22:22344525-22344547 CTGTGACCAGCAGGAGCAATGGG + Intergenic
1181962055 22:26629225-26629247 CCCTGCCTACCAGGAGCCAAGGG - Intronic
1182301173 22:29337950-29337972 CCTGGCACAGCCGGAGCCATTGG - Intronic
1184040565 22:41940667-41940689 CCGTGCCCAGCAGGAAGCTGGGG + Intronic
1184799800 22:46752534-46752556 CCTTCCCCACCAGGAGACATGGG + Intergenic
1185116624 22:48941704-48941726 CAGTGCCCAGGATGAGCCAGTGG - Intergenic
949290711 3:2462322-2462344 TTGTGCCCAGCAAGAGCCAATGG + Intronic
950701990 3:14757283-14757305 CTTTGACCAGCAGGAGCCAGGGG + Intronic
950925618 3:16738242-16738264 TGGTGCCCAGCATAAGCCATTGG + Intergenic
954649626 3:52153340-52153362 CCTTTCCCAGGAGGAGCCTTTGG - Intronic
958851158 3:99327232-99327254 CCTTGCCCAGCAGAAACCTTTGG + Intergenic
959009739 3:101061274-101061296 CCATCCCCAACAGCAGCCATAGG - Intergenic
960697155 3:120407342-120407364 CCCTGGCCATCAGGAGCCACAGG + Intronic
961821074 3:129575934-129575956 CCTTTCCCAGCAGGAGCCCGTGG - Intronic
963458702 3:145578755-145578777 ACAAGCCCAGCAAGAGCCATAGG + Intergenic
966820101 3:183917481-183917503 CTGTGCCCAGCAGAAGGTATGGG + Intergenic
968443151 4:634540-634562 CAGTGCCCAGCAGGGCCCCTGGG + Intronic
968748227 4:2372177-2372199 CCGTGACCAACAGGACCCAAAGG + Intronic
968830614 4:2931497-2931519 CCGTGCCCTGCAGGACTCAGGGG + Intronic
968899413 4:3423986-3424008 CCGGGCCCAGCAGGTGCAGTGGG - Intronic
969513145 4:7631229-7631251 CTGAGCCCTGCAGGAGCCAGCGG - Intronic
969864995 4:10069487-10069509 CCAAACCCAACAGGAGCCATAGG - Intergenic
974438975 4:61892937-61892959 CCATGCCCTGCAGGAACTATAGG + Exonic
980462480 4:133134183-133134205 GCGTACCCAGCAGGAACCCTTGG - Intergenic
983958740 4:173727399-173727421 CTGTCCCCAGCAGGAGGCACAGG + Intergenic
989762011 5:45026813-45026835 CTGTGCTCAGCATTAGCCATTGG - Intergenic
991299955 5:65120553-65120575 CCTTCCCCAGCAGGAGCCAGGGG + Intergenic
991317790 5:65329579-65329601 CCATGCACAGAAGGAGCCGTTGG + Intronic
993279271 5:85904833-85904855 CCGTGCACAGAAGGAGCATTTGG + Intergenic
997698222 5:135878216-135878238 CCGGGCCCTGCAGGAGCTGTGGG - Intronic
1000371946 5:160545188-160545210 CCCTTCACAGCAGTAGCCATAGG + Intergenic
1001307478 5:170585891-170585913 CCAAGCCCTGCAGGAGCCAGTGG + Intronic
1004199210 6:13532442-13532464 CAGCTCCCAGAAGGAGCCATGGG + Intergenic
1006164454 6:32056410-32056432 CCCTGCTCAGGAGGAGCCAGGGG + Intronic
1006679430 6:35786862-35786884 CCCTGCCTGGCAGGAGCCAGAGG + Intronic
1007122679 6:39396413-39396435 CCGAGCCCAGCAGGTGCACTGGG + Intronic
1013351137 6:109306826-109306848 TGGTGCCCACCAGCAGCCATAGG - Intergenic
1014109252 6:117602251-117602273 CCATGCCCAGCAGCAGCCGGAGG - Exonic
1015875239 6:137816058-137816080 CAGTGGCCAGGAGAAGCCATGGG - Intergenic
1018058431 6:160071347-160071369 GGGTGCCCAGCAGGAATCATGGG + Intronic
1018095720 6:160385605-160385627 CTGTGCGCAGCTGGACCCATGGG + Intronic
1018528532 6:164739069-164739091 CGGTGCCCAGCTGGAGGCAGCGG + Intergenic
1018832768 6:167457708-167457730 CCCCGCCCAGCAGGAGCTCTGGG + Intergenic
1018906194 6:168077595-168077617 CCAGGCCCAGCAGGGGCCACAGG + Intronic
1022298930 7:29084208-29084230 CCGGGCCCTGCAGGATCCACTGG + Intronic
1022531155 7:31067690-31067712 CCGGGCGCAGCACCAGCCATGGG + Intronic
1024981994 7:55165337-55165359 ACCTGCCCGGCAGGAGTCATGGG + Exonic
1026898047 7:74021917-74021939 CCAGGCCCAGCAGGAGCCCCTGG + Intergenic
1028348429 7:89813304-89813326 CAGTGTACAGCAGGGGCCATTGG + Intergenic
1029280235 7:99430679-99430701 ACCTGCCCAGCAGCAGCCCTGGG + Intronic
1030085464 7:105811837-105811859 CTTGGCCCACCAGGAGCCATGGG - Intronic
1036808405 8:11850860-11850882 CCTTACCCAGCAGGAGCCACAGG + Exonic
1038188836 8:25300306-25300328 CTGTGCCCACCAGGAGCAGTGGG + Intronic
1038446460 8:27607812-27607834 CCTTGCCCAGCAGGGGACAGGGG - Intronic
1041919657 8:63168168-63168190 CCGGGCCTAGCAGGAGCCTTCGG - Intergenic
1042406776 8:68414947-68414969 AGGTGCCCAGCTGGAGCCATTGG - Intronic
1047718703 8:127619385-127619407 CCTTCCCCACCAGGACCCATGGG + Intergenic
1047718722 8:127619444-127619466 CCTTCCCCACCAGGAACCATGGG + Intergenic
1047718739 8:127619503-127619525 CCTTCCCCACCAGGACCCATGGG + Intergenic
1048996214 8:139795158-139795180 CCTTCCCCAGCAGGGCCCATGGG - Intronic
1049525780 8:143126202-143126224 CTGTGCCCATCCTGAGCCATCGG - Intergenic
1049637535 8:143697068-143697090 CCCTGCCCAGCGGGCGCCGTTGG + Intronic
1056692708 9:88822049-88822071 CTTTGCCCAGCAGGAAGCATGGG - Intergenic
1057725468 9:97565076-97565098 ATGTGCCCAGTAGGAGACATTGG + Intronic
1057783798 9:98071929-98071951 CCGTGCCCTGCAGGTGGCATCGG + Intronic
1058757593 9:108097650-108097672 CTGTTCCCTGTAGGAGCCATTGG + Intergenic
1060974950 9:127759504-127759526 CTGTGCCCAGCCTGAGCCACTGG + Intronic
1061065979 9:128277642-128277664 CCCTGCCCTCCAGGAGCCACAGG + Intronic
1061808609 9:133149661-133149683 CCGAGTCCAGCAGGTGGCATCGG - Intergenic
1061907911 9:133708256-133708278 CAGTCCCCAGCAGGAGCTGTAGG + Intronic
1062220755 9:135413810-135413832 CAGGGGCCAACAGGAGCCATGGG + Intergenic
1062345208 9:136111269-136111291 CCGTCCCCAGGAGCAGCCAGCGG + Intergenic
1062609294 9:137366798-137366820 CAGAGCCCAGCAGGAGCCTTGGG - Intronic
1062722547 9:138051929-138051951 CCTTGCCCTGCAGGTGCCACAGG - Intronic
1185722234 X:2391457-2391479 CCTTTCCCAGGAGGAGCCATAGG + Intronic
1190879691 X:54483525-54483547 CCTTTCCCTGCAGGGGCCATGGG + Intronic
1192568246 X:72181380-72181402 GCGTGCGCAGTAGGAGCCACGGG - Intronic
1195129966 X:101841816-101841838 CCTGGCTCAGCAGGGGCCATTGG - Intronic
1195176255 X:102317968-102317990 CCTGGCTCAGCAGGGGCCATTGG + Intronic
1195182609 X:102369125-102369147 CCTGGCTCAGCAGGGGCCATTGG - Intronic
1197675257 X:129323111-129323133 CCTAGCTCAGCAGGAGCTATGGG - Intergenic
1200303957 X:155006554-155006576 CCGCGCCCAACAGGAACCACAGG + Intronic
1200317429 X:155148352-155148374 CCGCGCCCAACAGGAACCACAGG - Intergenic