ID: 1180157648

View in Genome Browser
Species Human (GRCh38)
Location 21:45985876-45985898
Sequence CGCTGTCTGCAGGGGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180157641_1180157648 8 Left 1180157641 21:45985845-45985867 CCTGGGGGACTTGGAGTCTCAGG 0: 1
1: 0
2: 3
3: 21
4: 202
Right 1180157648 21:45985876-45985898 CGCTGTCTGCAGGGGGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 190
1180157639_1180157648 19 Left 1180157639 21:45985834-45985856 CCAAGCTGGGACCTGGGGGACTT 0: 1
1: 0
2: 3
3: 44
4: 275
Right 1180157648 21:45985876-45985898 CGCTGTCTGCAGGGGGTGCATGG 0: 1
1: 0
2: 0
3: 20
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180157648 Original CRISPR CGCTGTCTGCAGGGGGTGCA TGG Intronic
900307366 1:2017648-2017670 TGCTGGCCGCAGTGGGTGCATGG + Intergenic
900518524 1:3094784-3094806 CCCTGGCTGCAGGGAGTCCAGGG - Intronic
900871646 1:5308530-5308552 GGCTGTCTGCAAGGTCTGCAGGG + Intergenic
900976082 1:6017225-6017247 AGGTGTCTGCAGGGGAAGCATGG + Intronic
901320198 1:8335383-8335405 CGCTGTGTGATGGGGGTGCGGGG + Intronic
902470021 1:16642771-16642793 CGGTGGCTGCTGGGGGTGCATGG + Intergenic
903058432 1:20653017-20653039 CTCTGCCTGCAGGTGGTGGAAGG - Intronic
903218404 1:21855436-21855458 CTCTGTCTGCAGGGGGCGGTGGG - Exonic
903280909 1:22249306-22249328 CCCTGCCTGCAGGAGGTGCTGGG - Intergenic
903607002 1:24582156-24582178 CGATGTGTGCAGGGGGTGGTCGG - Intronic
906538005 1:46562648-46562670 CGAGGTCTGCAGGGTGTGCCAGG - Exonic
907285704 1:53378185-53378207 CCCTGACTGCAAGGGGTGCTGGG - Intergenic
911263900 1:95720507-95720529 ATCTGTCTGCAAGGGGTGGAGGG - Intergenic
916481830 1:165221272-165221294 GGCTTTCTGGAGGGGGTGAAAGG + Intronic
916721100 1:167485276-167485298 AGCTGTGAGCAGGGCGTGCAGGG - Intronic
919808867 1:201396942-201396964 GCCTGTCTGCAGGGGGTGAGGGG - Intronic
923129326 1:231061542-231061564 CATTGTCTGGAGGTGGTGCAGGG - Intergenic
923503058 1:234582458-234582480 CTCTGTCTGCAGTGGGTGAAAGG - Intergenic
1062791777 10:311334-311356 CGCTGTCTTCCCGGGGTGCGCGG - Intronic
1064236115 10:13577384-13577406 CGGGGCCTGCAGGGGGTGGAGGG - Intergenic
1066976130 10:42369249-42369271 GGCTGTCTACACTGGGTGCATGG + Intergenic
1067099647 10:43325298-43325320 TGGTGTCTGCATGGGCTGCATGG + Intergenic
1067286978 10:44914027-44914049 TCCTGTCTGCAGGGGGTCCAGGG - Intronic
1067830522 10:49609208-49609230 CGCTGTCGTCAGGGGCTCCAGGG - Intronic
1069568258 10:69478188-69478210 GGCTGTCTGCAGGGTGGGCTTGG + Intronic
1070566445 10:77606904-77606926 GGCTGGCTGCAGAGGGTGCAAGG - Intronic
1071337569 10:84613457-84613479 CTCTGCCTGCAGGGGGCTCATGG - Intergenic
1072751739 10:97985736-97985758 CTCTGTGTGCAGGGGTTGAAGGG - Intronic
1073177661 10:101566268-101566290 AGCTGTATGTAGGGGGGGCAGGG - Intergenic
1074705507 10:116126403-116126425 TGCTGTCTGCAGCGAGAGCATGG + Intronic
1075782497 10:125026380-125026402 CCCTGCCTGCAGGGGGTACGTGG + Exonic
1076471357 10:130720832-130720854 GTCTGTGTGTAGGGGGTGCAGGG - Intergenic
1077211958 11:1375291-1375313 CTCTGTCTGCTGGGGTTGGAGGG - Intergenic
1077352772 11:2100574-2100596 ACCTGTCTGCGGGAGGTGCAGGG + Intergenic
1078439245 11:11350622-11350644 TCCTGACTGCAAGGGGTGCAGGG - Intronic
1081570880 11:44290061-44290083 GGCTGGATGCAGGAGGTGCAGGG - Intronic
1085052215 11:73385596-73385618 CACTGTCTGGTGGGGGAGCAAGG + Intronic
1085466027 11:76723912-76723934 CCTTGGCTGCAGGGGCTGCAGGG - Intergenic
1089642513 11:119857068-119857090 TGCAGGCTGCAGGGGTTGCAGGG + Intergenic
1089677941 11:120102742-120102764 AGCTGTCTGCAGGGGTTGGCCGG - Intergenic
1090029416 11:123194802-123194824 GGCTGACTCCAGGGGCTGCAGGG + Intronic
1091329265 11:134717967-134717989 CACTGTCTGCTGGGTGTGAAGGG - Intergenic
1092779612 12:11973284-11973306 CTGTGTCTTCAGGGGGTTCACGG + Intergenic
1106000309 13:25716624-25716646 CACTGTCAGCAGGGTGTGAAGGG + Intronic
1115769375 14:36654737-36654759 CGCTGTTTGCAGGGAATGAAAGG + Intergenic
1120863420 14:89275272-89275294 CTGTGTCTGCTGCGGGTGCAAGG - Intronic
1122122058 14:99560038-99560060 GGCTGTGTGCAGGGGGTGAGTGG - Intronic
1122334711 14:100963970-100963992 GGCTGTCTGCAGTAGGAGCATGG + Intergenic
1123017503 14:105382372-105382394 CTGTGGCTGCAGGGGGAGCAGGG + Intronic
1123771841 15:23536999-23537021 GGCTGTCCACAGGGGCTGCAGGG - Intergenic
1124202921 15:27693844-27693866 CGCAGTCTTGAGGGGGTGCAGGG - Intergenic
1124436878 15:29657465-29657487 CGCTGTCGGCTGGGGGGGCGGGG + Intergenic
1127968541 15:63941891-63941913 AGCTGACTGCATGGGGTGCCAGG - Intronic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1132080566 15:98861402-98861424 CGCTGCATGCAGAGGGTGTAAGG - Intronic
1132222241 15:100113629-100113651 GCCAGTCTGCAGTGGGTGCACGG + Intronic
1132572803 16:651362-651384 TGCTGGCTGCAGCTGGTGCAGGG + Intronic
1133022093 16:2971257-2971279 CGGAGCCTGCAGGGGGTGCAAGG - Exonic
1137733787 16:50709549-50709571 CTCTCCCTGCATGGGGTGCATGG + Intronic
1138495313 16:57405347-57405369 CGCTGTCTTCAGTGGGAGCTTGG - Intronic
1141417927 16:83891125-83891147 TGCTGTCTGAAGAGGGTGCCAGG - Intergenic
1141578697 16:84982519-84982541 CCCTGTCAGCAGGGGCTACAGGG - Intronic
1141684092 16:85560551-85560573 TGCTGGCTGCAGGGAGAGCAAGG + Intergenic
1141690804 16:85595203-85595225 CGCAGTCTGGAGGGGATGCAGGG - Intergenic
1141998917 16:87652890-87652912 CTGTGTCTGTAGTGGGTGCAGGG - Intronic
1142244079 16:88961070-88961092 CGCTGTGGGCAGGTGGTGGATGG + Intronic
1142323717 16:89400894-89400916 GGGTGTCTGCAGAGGGTGGAGGG - Intronic
1142359572 16:89619778-89619800 CGCTGCAGGGAGGGGGTGCAGGG - Intronic
1147325963 17:39669760-39669782 CGCTGGCTGCAGGAGGAGCCGGG + Exonic
1148792380 17:50180668-50180690 CTCTGTCTCCTGGGGGTGCCTGG - Intergenic
1150645234 17:66973736-66973758 TGCTCTCTCCAGCGGGTGCATGG + Intronic
1152457746 17:80425846-80425868 GGCTGAGTGCATGGGGTGCAGGG - Intronic
1152478290 17:80532787-80532809 GGCTCTCTGCAGGGGGTAAAAGG + Intergenic
1157327317 18:46678539-46678561 CTGTGTCTTCTGGGGGTGCAGGG - Intronic
1158947497 18:62459598-62459620 GGCTCTCTGCAGGGGCTGCTGGG + Intergenic
1159985526 18:74836476-74836498 TGCTGTGTGCTGGGGGAGCAGGG - Intronic
1160725099 19:614354-614376 TGCTGTGTGCTGGGGGTGCAGGG + Intronic
1160889471 19:1369579-1369601 CGCAGCCTGCAGGGGGTGGAGGG - Exonic
1161041733 19:2114055-2114077 CGCTGTCTCCTGGGAGTTCACGG + Intronic
1161993565 19:7698849-7698871 CGATCTCTGCCGGGGGTGGAGGG + Exonic
1162958803 19:14114246-14114268 CCCTGCCTGCAGGGGGAGCTAGG + Intronic
1163720342 19:18895607-18895629 CACTGTCTGAAGGGGGCGCGCGG + Intronic
1164574541 19:29397991-29398013 TCCTGTCTGCAGGGGGTTCCTGG - Intergenic
1164593478 19:29518957-29518979 TGCTGCCTGCAGTGGGTGAATGG - Intergenic
1165395196 19:35560068-35560090 CGGTGCCTGCAGGGGGGCCAAGG + Exonic
1165732635 19:38156155-38156177 TGCTGTCTCCAGGGTGTGCGTGG + Intronic
1165734027 19:38164567-38164589 CTCTGGCTCCAGGGGGTCCAGGG - Exonic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925778485 2:7357552-7357574 CGATGACTCCAGGAGGTGCAGGG - Intergenic
927554866 2:24024279-24024301 CGCTGGCTGCAGGGGGCGTGCGG - Exonic
931671894 2:64654458-64654480 CGCTGCCTGCAGGGGTTCCTGGG + Intronic
932485162 2:72080373-72080395 TGGTGGCTGAAGGGGGTGCATGG + Intergenic
935129471 2:100250669-100250691 CGCTGTTTCTAGAGGGTGCATGG + Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
936055347 2:109258240-109258262 CGCTGTTTGTAGGGGCTGAAGGG + Intronic
937292063 2:120787706-120787728 CGCTGTCTGCAAGGGGAACAAGG - Intronic
937303054 2:120854988-120855010 CTCTGTGTGGAGGGTGTGCAGGG - Intronic
938122740 2:128645185-128645207 GCCTGTCTGCAGGGGGAGCAGGG + Intergenic
947576186 2:231276632-231276654 CGCTGTCTGCAGCGGGCGCCTGG - Exonic
948254286 2:236554656-236554678 CGCAAACAGCAGGGGGTGCAGGG + Intergenic
948281644 2:236751772-236751794 CGCTGCATGCAGGGAGGGCAGGG - Intergenic
948541286 2:238692963-238692985 TGCTGTCTGCAGCAGGTGCATGG + Intergenic
948862299 2:240758492-240758514 CGCTGCCTGCAGGGACGGCAGGG + Exonic
1169843121 20:9961451-9961473 TGATGGCTGTAGGGGGTGCATGG - Intergenic
1172127282 20:32632202-32632224 TGCTGACTGCTGGGAGTGCAGGG - Intergenic
1172317989 20:33971241-33971263 CGCTGACAGCAGGAGGGGCAGGG - Intergenic
1172846962 20:37935307-37935329 CGCTGTCTGCACGAGGAGCTTGG - Intronic
1173618325 20:44417384-44417406 CATTCTCTGCAGGGGGTACAAGG - Intronic
1173688979 20:44944390-44944412 CACTGTTTTCAGTGGGTGCAGGG + Intronic
1174330714 20:49815103-49815125 CCCTGTCTGCACGGGGAGGATGG - Exonic
1178151940 21:29805140-29805162 CTGTGGCTGCAGGGGGTGGAGGG - Intronic
1180149003 21:45938144-45938166 CCCTGTTTGCAGGAGGGGCAGGG + Intronic
1180157648 21:45985876-45985898 CGCTGTCTGCAGGGGGTGCATGG + Intronic
1180782656 22:18529601-18529623 CGCTGTCTGCAGCGCGTCCTGGG - Exonic
1181126216 22:20703628-20703650 CGCTGTCTGCAGCGCGTCCTGGG - Intergenic
1181239546 22:21468939-21468961 CGCTGTCTGCAGCGCGTCCTGGG - Intergenic
1182087745 22:27573317-27573339 TGCTGCCTGCCGGGGCTGCAGGG + Intergenic
1182505926 22:30782308-30782330 GGTTGTCTGCAGGAGGTGGAAGG - Intronic
1183563484 22:38595342-38595364 CCCTGTCTGCAAGGGAAGCATGG - Intronic
1184039357 22:41933923-41933945 CACTGTCTGTAGAGGGTGGAAGG + Intergenic
1184583334 22:45431247-45431269 TGCTGTCCACACGGGGTGCATGG + Intronic
1184912968 22:47548329-47548351 TTTTGTCTGCAGGGGGTGCCTGG + Intergenic
1184978849 22:48081822-48081844 CGCTGTCTCCAGGGTCTGGAAGG + Intergenic
1185053856 22:48567793-48567815 CGCTGTCTGCAGGGTGGCCTGGG + Intronic
1185168740 22:49278598-49278620 TGCTGTGTGCAGGGGTTGCCTGG + Intergenic
1185171578 22:49297581-49297603 CCTTCTCTGCAGGGGGTGCCTGG - Intergenic
949891131 3:8734374-8734396 CGGTCTCTCCAGTGGGTGCAGGG + Intronic
950595544 3:13977658-13977680 TGGTGTCTGCCGGGGGTGGAAGG + Intronic
952023909 3:29056070-29056092 AGCTGTCAGCAGAGAGTGCAAGG + Intergenic
954448292 3:50558255-50558277 TGCTGGCTGGAGGGGATGCAGGG - Exonic
955197497 3:56818713-56818735 GGATGGCAGCAGGGGGTGCAGGG - Intronic
961115208 3:124323394-124323416 CCCTGTGGGCAGGGGGTGGATGG + Intronic
961461519 3:127053098-127053120 GGCTGCCTGCAGGAGATGCAAGG - Intergenic
961539614 3:127590648-127590670 CGCTGTCGGGAAGGGCTGCAGGG - Exonic
962735051 3:138318246-138318268 CCCTGGATGCAGGGGGTGCAGGG + Intronic
967017960 3:185498593-185498615 TGCTGGCTGCAGGGTGTGCAGGG - Intronic
968047184 3:195631009-195631031 CTCTGTCTGTGGGGGCTGCAGGG + Intergenic
968307417 3:197658855-197658877 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307431 3:197658915-197658937 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307449 3:197658975-197658997 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968307463 3:197659035-197659057 CTCTGTCTGTGGGGGCTGCAGGG - Intergenic
968662647 4:1805154-1805176 CCCTGTCTGGAGGGGCAGCAAGG + Intronic
968981559 4:3852683-3852705 GTCAGTCTGCAGGGGATGCACGG + Intergenic
969306218 4:6327644-6327666 CCCTGTCTGCTGGGGGTGTCTGG + Intronic
970404437 4:15748656-15748678 CTCTGGCTGCAGGGGGTGAGGGG + Intergenic
971201780 4:24515910-24515932 CACTGGCTGCAGGTGGTGTAAGG + Intergenic
978576654 4:110196583-110196605 CGCTGAGGCCAGGGGGTGCAGGG - Intronic
983453325 4:167933071-167933093 CACTGTCTGTGGGGTGTGCATGG - Intergenic
984702283 4:182826006-182826028 CGCAGGCTGCTGGCGGTGCATGG + Intergenic
985655920 5:1131300-1131322 CCCTGTCTGCAAGTGGTGCCAGG - Intergenic
985725669 5:1514696-1514718 CACTGTCTGCAGCGCCTGCATGG - Intronic
985744418 5:1638120-1638142 CCCTGTCTGTGGGGGCTGCAGGG - Intergenic
985947190 5:3194972-3194994 CACCTTCTGCAGGGGCTGCATGG - Intergenic
997634966 5:135398521-135398543 CGCTATCTGCAGGGAGGGGAAGG - Intronic
997665679 5:135627962-135627984 CTCAGTGTGCAGGGGGTTCATGG - Intergenic
997825911 5:137106712-137106734 CACTGGCTGCAGGGTGGGCATGG - Intronic
998224770 5:140318434-140318456 AGGTCTCTGCATGGGGTGCAGGG + Intergenic
1001580963 5:172798086-172798108 AGCTGTTTGCATGGGGTGCCTGG - Intergenic
1001908044 5:175489398-175489420 AGCTACCTGCAGGGCGTGCAGGG - Intronic
1002416847 5:179125257-179125279 CGCTGTCTACCTGGGCTGCAGGG - Intronic
1002789133 6:424867-424889 AGCTGTCTGCAGAGGGAGCCTGG - Intergenic
1003831222 6:10014143-10014165 TGATGTCTGCAGGGGGTGGAGGG - Intronic
1003897544 6:10622025-10622047 GGCTGCCTGTAGGGGGAGCAGGG - Intronic
1006266305 6:32927486-32927508 CGATGTCTGCAGGGTGTGTAGGG - Intergenic
1006417185 6:33911627-33911649 CGCTGTCTCCAGCAGGTGCCAGG - Intergenic
1007473056 6:42103285-42103307 CTCTGTCTGGTGGGTGTGCAGGG - Exonic
1017744823 6:157436896-157436918 AGCTGTCTGCAGGGAGTACAGGG + Intronic
1017759660 6:157558181-157558203 CACTGTCTGCAGGGGGCTCTTGG - Intronic
1017931196 6:158957209-158957231 CGCTGTAGACAGGGAGTGCAGGG - Intergenic
1018262814 6:161987433-161987455 TGCTGTCTGCAGGGGGTTTCTGG - Intronic
1018265129 6:162016355-162016377 GGCAGTCTGCAGGGGTTCCAAGG - Intronic
1018905265 6:168072209-168072231 CCCTCCCAGCAGGGGGTGCAGGG - Intronic
1018924809 6:168198632-168198654 AGCTGCCTGCAGAGGATGCACGG + Intergenic
1019156161 6:170040198-170040220 GTCTTTCTGCAGGGGGTGGAAGG - Intergenic
1020116169 7:5477788-5477810 CGCTGCCTGCTGGGGGATCAAGG + Intronic
1022286916 7:28962187-28962209 GTCTGGCTGCAGGGGGTGCGAGG + Intergenic
1025227476 7:57177878-57177900 CTTTGTCTGCAGTGGGTGAATGG - Intergenic
1025230594 7:57201327-57201349 CTGTGTCTGCAGTGGGTGAATGG - Intergenic
1025730399 7:64102429-64102451 CTGTGTCTGCAGTGGGTGAATGG + Intronic
1025928901 7:65979901-65979923 CTGTGTCTGCAGTGGGTGAATGG - Exonic
1026807186 7:73435841-73435863 AGCTGTCTCTAGGGGATGCAGGG - Exonic
1029013123 7:97283407-97283429 CGCTGTTCACAGGGGTTGCAAGG - Intergenic
1029633453 7:101767945-101767967 CGGAGTCTGCAGGGGTTGTAGGG + Intergenic
1029639741 7:101813589-101813611 TGCTCTCTGCAGGGGGTGGTGGG - Intergenic
1032003902 7:128284964-128284986 CGCTGTCAGCTGGGGCTGGAGGG + Intergenic
1034003574 7:147443383-147443405 CACTGCCTGCAGGTGGTGGAGGG + Intronic
1034250507 7:149686851-149686873 AGCTGTCAGCAGAGAGTGCAAGG + Intergenic
1035203336 7:157279948-157279970 CGCTGACCGCAGGGGGCACAGGG + Intergenic
1035257897 7:157643687-157643709 GGGTGTCTGCAGGGGGTCCTTGG - Intronic
1035353557 7:158263881-158263903 CGCTGGGTGCAGGGTGTGCTAGG - Intronic
1036651318 8:10645954-10645976 GGCTGCCTGCAGGGGGTTGAAGG - Intronic
1037382309 8:18299369-18299391 CGCTGTTTGCTGGGGTTGCAGGG - Intergenic
1039225757 8:35386584-35386606 CTCTGCCTGCACTGGGTGCACGG + Intronic
1044743151 8:95347993-95348015 TGCTGTCTGGTGGGGGAGCAAGG - Intergenic
1048312992 8:133340260-133340282 TGCTGTCTGCAGGGGCAGTATGG - Intergenic
1049402516 8:142435882-142435904 CCCAGGCAGCAGGGGGTGCATGG + Intergenic
1049716616 8:144095900-144095922 TGCTGGCGGCAGGGGGTGCGGGG + Exonic
1050547815 9:6723582-6723604 GGCTCTCTTCAGGGAGTGCAAGG - Intronic
1050878637 9:10673456-10673478 AGCTGAGTGCAGGGAGTGCAGGG + Intergenic
1051448724 9:17171485-17171507 AGGTGTCTGCAGGGGGAGCGAGG + Intronic
1053053059 9:34977320-34977342 GGCTGTTGGCAGGGGGAGCAGGG - Intronic
1053061716 9:35036921-35036943 TGCTGGCTGCTGGGGGTGGAGGG + Intergenic
1053409168 9:37904404-37904426 CGCTGCCTGCAGGGGGCGTCTGG + Intronic
1057598489 9:96437010-96437032 CCCTGTCTTCAAAGGGTGCACGG - Intergenic
1061416955 9:130452151-130452173 GGCTGTCTGCAGGGGCTGGCGGG + Intronic
1061418747 9:130462015-130462037 TGCTGTCTGGACGGGGTGCTGGG - Intronic
1062402960 9:136380465-136380487 CGCTGTCTGCCGGGGATGCCTGG - Intronic
1062539473 9:137035240-137035262 CGCTGTCTGCAGGGGGCAGCTGG - Exonic
1185835999 X:3346452-3346474 GTCTGCCTGCAGGGGGTGAAGGG - Intronic
1192153157 X:68724379-68724401 CGCTGCCTGCAGGGTGGGGAAGG - Exonic
1200083561 X:153591696-153591718 GGCAGTGTGCAGGTGGTGCAGGG - Intronic