ID: 1180159359

View in Genome Browser
Species Human (GRCh38)
Location 21:45992196-45992218
Sequence GAAAGGAGAGGCGGGCGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 256}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180159342_1180159359 16 Left 1180159342 21:45992157-45992179 CCCACAGGGCCAGCCGGGAGAGC 0: 1
1: 0
2: 1
3: 11
4: 164
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159343_1180159359 15 Left 1180159343 21:45992158-45992180 CCACAGGGCCAGCCGGGAGAGCC 0: 1
1: 0
2: 0
3: 33
4: 266
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159338_1180159359 24 Left 1180159338 21:45992149-45992171 CCTTGTTCCCCACAGGGCCAGCC 0: 1
1: 0
2: 3
3: 31
4: 293
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159347_1180159359 3 Left 1180159347 21:45992170-45992192 CCGGGAGAGCCTGGGCCCCCCGG 0: 1
1: 0
2: 8
3: 44
4: 395
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159346_1180159359 7 Left 1180159346 21:45992166-45992188 CCAGCCGGGAGAGCCTGGGCCCC 0: 1
1: 0
2: 4
3: 22
4: 294
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159341_1180159359 17 Left 1180159341 21:45992156-45992178 CCCCACAGGGCCAGCCGGGAGAG 0: 1
1: 0
2: 2
3: 30
4: 257
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159349_1180159359 -6 Left 1180159349 21:45992179-45992201 CCTGGGCCCCCCGGAGAGAAAGG 0: 1
1: 0
2: 1
3: 26
4: 251
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256
1180159337_1180159359 25 Left 1180159337 21:45992148-45992170 CCCTTGTTCCCCACAGGGCCAGC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG 0: 1
1: 0
2: 0
3: 20
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180159359 Original CRISPR GAAAGGAGAGGCGGGCGACG AGG Exonic
900030788 1:371171-371193 GAAAGGGTAGCCGGGCGAGGTGG - Intergenic
901081157 1:6585060-6585082 AAAAGCAGAGGCGGGCCAAGGGG + Intronic
902286832 1:15412592-15412614 GAAAGGAGAGACGGGGGCTGGGG - Intronic
902583855 1:17426153-17426175 GAAAGGAGGGGCAGGCGGCAGGG - Intronic
902694198 1:18129309-18129331 GAAATGAGAGGTGGGAGAGGAGG + Intronic
903413843 1:23168325-23168347 GACAGGGGCGGGGGGCGACGAGG - Intronic
904055117 1:27664953-27664975 GAAAGGAGATGGGGGCGGGGAGG + Intergenic
904165657 1:28553233-28553255 GAAAGGGGAGACGTGTGACGGGG + Intronic
904890618 1:33776802-33776824 GAAAGGAGCAGGGGGCGATGGGG + Intronic
905734281 1:40315307-40315329 GAAAGGAGAGGAGGGGGATGAGG + Intronic
906250546 1:44307689-44307711 GAAAGAGGAGGCTGGTGACGTGG + Intronic
908262444 1:62349509-62349531 GAAAGGAGAGGAGGGGGAAGTGG + Intergenic
910183873 1:84514130-84514152 GAAAAGAGAGCCGGGCGTGGTGG - Intergenic
913429723 1:118777183-118777205 GAAAGGAGGGGAGGGCAACCAGG + Intergenic
913527445 1:119707497-119707519 GAAAGGAAAGGAGGGAGAAGAGG - Intronic
915462832 1:156080395-156080417 AAAAGGGGAGGCGGGCCAGGGGG - Intronic
915561874 1:156692507-156692529 GACAGGAGAGGAGGGGGAGGGGG + Intergenic
915591173 1:156871507-156871529 GAAAGGAGAGGAGGGCTGGGAGG - Intronic
917972862 1:180219793-180219815 AGAAGGAGGGGTGGGCGACGTGG + Intergenic
918905295 1:190484265-190484287 GAAAGTAGAGGAGGGGGAGGTGG + Intergenic
920367035 1:205453588-205453610 GAAGGGAGAGACGGGAGACCTGG + Intronic
922440728 1:225653239-225653261 GAAAGGGGAGGCGGGGGGCCGGG + Intergenic
924482772 1:244451842-244451864 CGAAGGAGAGGCGGCCGGCGAGG + Exonic
1065899181 10:30189580-30189602 GGATGGAGAGGTGGGCAACGTGG + Intergenic
1066402522 10:35090070-35090092 GAGAGGAGTTGGGGGCGACGAGG - Intronic
1068190175 10:53641544-53641566 GGAAGGAGAGGCAGGAGAGGCGG + Intergenic
1069647897 10:70017678-70017700 GAGGGGAGAGGAGGGCGAGGGGG + Intergenic
1073115129 10:101087577-101087599 GAAAGGAGCGGCGGCCGCCCCGG + Intergenic
1073643515 10:105276486-105276508 GAGAGGAGAGGCTGGTGAAGAGG + Intergenic
1074536944 10:114334807-114334829 GCAGGGAGAGGCAGGAGACGGGG + Intronic
1074539859 10:114355383-114355405 GAGAGGAGAGCCGGGCGTGGTGG - Intronic
1074885426 10:117689298-117689320 GAAGGGAGAGGAGGGCCTCGAGG + Intergenic
1074995105 10:118750037-118750059 GAAAGGAGGGCCGGGCGTGGTGG + Intronic
1075001678 10:118803258-118803280 GAAAGGAGAGGGAGCCGAGGAGG + Intergenic
1076642756 10:131929867-131929889 GAGAGGAGGGGCAGGTGACGAGG - Intronic
1078374692 11:10783969-10783991 GAAAGGAGAGGGGTGCAACTGGG - Intergenic
1078390561 11:10932145-10932167 GAAAGGAGAGGAGGAGGAGGTGG + Intergenic
1079076624 11:17388823-17388845 GACAGGTGAGGCGGGAGACCCGG - Intronic
1079837843 11:25356273-25356295 GAAAGGAGAGGAGGGGGAGAAGG + Intergenic
1081534535 11:43987418-43987440 GGAAGGTGTGGCGGGGGACGGGG + Intergenic
1081597272 11:44467739-44467761 GAAAGGAGAGGCGAGGGAAGGGG - Intergenic
1083575837 11:63790599-63790621 GAAGGGAGGGGCGGGCGTGGTGG + Intergenic
1083802101 11:65052774-65052796 GGAAGGAGAGGAGGGCAAGGAGG - Intronic
1083815772 11:65131599-65131621 GAAGGGAGAGGGGGACGAGGGGG + Intronic
1084074471 11:66762315-66762337 GAAAGGCGGGGCGGGCCCCGGGG + Intronic
1085460372 11:76689692-76689714 GAAGGGAGAAGAGGGCCACGGGG + Intergenic
1086266317 11:85002756-85002778 GAAAGGGGAGGCAGGAGAAGCGG - Intronic
1089486859 11:118853276-118853298 GAAAGGGGAGGAGGCCGGCGCGG - Intergenic
1090028617 11:123188457-123188479 GAAAGGAGAGGAGGAGGAGGAGG - Intronic
1091074923 11:132606558-132606580 GAAAGTGGAGGTGGGAGACGGGG - Intronic
1092462422 12:8698184-8698206 GGAAGGAGAGGAGGGGGAGGGGG - Exonic
1092868693 12:12786910-12786932 GAATGGAGAGGCCGGCGGCCCGG + Exonic
1093757242 12:22866459-22866481 GATAGGAGAGGAGGGTGACCTGG - Intergenic
1094753482 12:33439713-33439735 GGAAGGAGAGGCGCGCGAGGAGG + Exonic
1096123961 12:49106313-49106335 GAAAAGAGAGGAGGGGGAAGGGG + Intronic
1103005653 12:117418152-117418174 GAAAGGGGAGGAGGGAGAGGAGG + Intronic
1104866777 12:131960723-131960745 GAAGGGAGCTGCGGGGGACGGGG - Exonic
1104914629 12:132258250-132258272 GAAAGGAGAGGAGGGACTCGGGG - Intronic
1107967640 13:45612201-45612223 AAAAGGAGAGGAGGGAGACTTGG - Intronic
1108396608 13:49996853-49996875 GCAGGCGGAGGCGGGCGACGGGG + Intronic
1111093436 13:83477371-83477393 GAAAGAAGAGGAGGGAGAAGAGG + Intergenic
1111306137 13:86414944-86414966 GAAAGGAGAGGTGAGAGAAGGGG - Intergenic
1112350126 13:98626303-98626325 GAGAGGAGAGGAGGGGGACGGGG + Intergenic
1112467725 13:99658513-99658535 GAAAGGAGGGGAGGCCGGCGTGG - Intronic
1112507052 13:99981652-99981674 GAGAGGAGAGGGGGGCTACCGGG - Intergenic
1115217256 14:31026062-31026084 GAACGGAGCGGCGGGCGGCGGGG - Exonic
1115399105 14:32938723-32938745 GAAAGGGGTGACGGGGGACGGGG + Intronic
1115493012 14:33977004-33977026 GATAGGAGGGGCGGGGGACTTGG - Intronic
1117169759 14:53081905-53081927 GAAGGGAGAGGAGGGGGATGGGG + Intronic
1119064392 14:71511282-71511304 AAAAGGAAAGGCGGGGGAGGGGG - Intronic
1120761838 14:88292252-88292274 GAAAGGGAAGGCGGGGGCCGTGG - Intronic
1121777068 14:96598118-96598140 GAGAGGAGAGGAGGGGGAAGAGG - Intergenic
1122634412 14:103123391-103123413 GGAAGGAGGGGCGGGCGGGGCGG + Intergenic
1124417541 15:29485591-29485613 GAAAGGAAAGGCTGGGGACAGGG + Intronic
1126330286 15:47524033-47524055 TCAAGGAGAGGCGAGGGACGTGG + Intronic
1127315844 15:57792938-57792960 GACAGGAGAGCCGGGCTGCGAGG + Intergenic
1128825592 15:70713055-70713077 GGAAGGAGAGCCGGGCGCAGTGG + Intronic
1130585203 15:85175269-85175291 GAAAGGAGGGGAGGGAGAAGAGG + Intergenic
1133286815 16:4694405-4694427 GAAAGGAGGGGCGGGGGTGGGGG + Intronic
1133768365 16:8853364-8853386 GAAGGCAGAGGCGGGAGAGGAGG + Exonic
1133945661 16:10346018-10346040 GAAAGGGGAGGCAGGAGAGGAGG + Intronic
1134615867 16:15650611-15650633 GGAAGGAGAAGAGGGCAACGGGG - Intronic
1134644708 16:15857082-15857104 GAAAGGGGAGGAGGCCGAAGGGG + Intergenic
1135382672 16:22007947-22007969 GAACGTAGAGGCGGGCGGTGCGG + Intronic
1135552457 16:23408434-23408456 GAAGGGAGAGGCGAGTGGCGGGG + Intronic
1135747778 16:25031931-25031953 GAATTGCGACGCGGGCGACGAGG + Intergenic
1136247719 16:28985085-28985107 GCACGGAGAGGCGGGCGCCGAGG + Intronic
1136377976 16:29876684-29876706 GACAGGACAGGCCGACGACGGGG + Intronic
1136394810 16:29987122-29987144 CAAAGGAGAGGCCGGCCAGGAGG - Exonic
1137493664 16:48952294-48952316 GAATGGAGAGGCGGGAGGGGTGG + Intergenic
1140954556 16:79849856-79849878 GAAAGGAGAGACTGCAGACGAGG - Intergenic
1140994520 16:80244358-80244380 GAATGGAGAGGCGGGAAATGTGG + Intergenic
1141451318 16:84105396-84105418 GAAAGGAGAGGCAGGCATCCAGG + Intronic
1141667759 16:85474656-85474678 AAAAGGAGAGGAGGGGGAAGAGG - Intergenic
1141713942 16:85716379-85716401 GAGAGGAGAGGAGGGAGAAGAGG + Intronic
1141822685 16:86458016-86458038 GAAGGGAGGGGAGGGCGACGAGG - Intergenic
1142274811 16:89112826-89112848 CATAGGAGAGGCAGGCGCCGTGG - Intronic
1142689396 17:1596031-1596053 GAAAAGAGAGCCGGGCGCGGTGG + Intronic
1142750518 17:1984677-1984699 AACAGGAGAGCCGGGCGCCGTGG + Intronic
1143202018 17:5119942-5119964 GAAAGGAGAGGCAGGAGAGGGGG - Intronic
1143689743 17:8550690-8550712 GAATGGAGAGGCGGGAGGGGTGG + Intronic
1143920041 17:10323892-10323914 GAAATGAGAGGCTGGCGTCAAGG - Intronic
1144010960 17:11148010-11148032 GGAAGGAGAGGAGTGCCACGGGG - Intergenic
1145243604 17:21253314-21253336 GAAAGGTCAGGCGCGCGGCGGGG + Exonic
1146926702 17:36750554-36750576 GAAGGGTGAGGCGGTGGACGAGG - Intergenic
1146927427 17:36754596-36754618 GAAAGGAGTCAAGGGCGACGAGG + Intergenic
1147260994 17:39209830-39209852 CCAAGGAGAGGCGGGCTGCGGGG - Intergenic
1147581536 17:41629891-41629913 GAAAGGAGAGGCAGGAGAGGGGG + Intergenic
1147966572 17:44197405-44197427 GACAGGAGAGGCTGGCGATCAGG + Intronic
1148458198 17:47822100-47822122 AAAATGAGAGGCGGGGGGCGGGG - Intergenic
1148975915 17:51528121-51528143 GCAAGGAGAGGTGGGGGGCGGGG - Intergenic
1152129244 17:78465980-78466002 GAATGGAGAGGCGGGAGGGGTGG + Intronic
1152321533 17:79610790-79610812 GCAGAGCGAGGCGGGCGACGAGG + Intergenic
1152563819 17:81091343-81091365 GAATGGAGAGGCCGGTGAAGAGG - Intronic
1152565131 17:81096971-81096993 GAAAGGAGAGGAGGAGGAGGAGG + Intronic
1152614353 17:81331007-81331029 GAAAGGAGAGGAGGGGGCGGGGG + Intergenic
1152948825 17:83214234-83214256 GAAAGGGTAGCCGGGCGAGGTGG + Intergenic
1153050172 18:894518-894540 GAAGGGAGAGGCGAGCAACCCGG - Intergenic
1153052139 18:909298-909320 CCAGGCAGAGGCGGGCGACGCGG + Intronic
1153295966 18:3547012-3547034 GAAATGAGAGCCGGGCGCGGTGG + Intronic
1156463239 18:37333354-37333376 GAAGGGAGAGGAGGGGGAAGAGG - Intronic
1157763454 18:50281437-50281459 GGAAGGGGAGGAGGGCGAGGCGG - Exonic
1159941545 18:74412512-74412534 GAAAGGAGAGAGGGGGGAAGTGG + Intergenic
1160018136 18:75159398-75159420 GAAAGGGGAGGCGGACTACAGGG - Intergenic
1160672870 19:374528-374550 GAAAGGAGAGGCGGGTGGGCAGG - Intronic
1161210363 19:3062430-3062452 GAGCGGGGAGGCGGGCGGCGGGG - Intronic
1161315878 19:3617479-3617501 GAAAGGAGGGCTGAGCGACGTGG + Intronic
1161438777 19:4279217-4279239 GAGGGGAGGGGCGGGGGACGCGG + Exonic
1161464750 19:4422696-4422718 AAAAGGAGAGGCGGGAGAAGCGG + Exonic
1162001318 19:7746704-7746726 GGAAGGGGAGGCTGGGGACGGGG - Intronic
1162548375 19:11344813-11344835 GAAAGGAGAGGGGAGGGAAGAGG - Intronic
1162552445 19:11365171-11365193 CAAAGGAGAGGAGGGAGATGAGG + Exonic
1165051907 19:33147244-33147266 AAAAGGAAAGGCGGGGGGCGGGG + Intronic
1165674061 19:37706270-37706292 GAAAGGAAAGGAGGGGGAAGGGG + Intronic
1165911348 19:39230113-39230135 GAGAGGAGAGGAGGGGGAGGGGG + Intergenic
1167454420 19:49591155-49591177 GGAAGGGGGGGCGGGCGGCGGGG - Intergenic
1167668873 19:50838617-50838639 GAAAGGAGAGGCTGGGGGCCGGG + Intergenic
1167770044 19:51509235-51509257 GACAGGTGAGGCTGGCGTCGTGG - Intergenic
926139945 2:10362533-10362555 GAAAGGTGAGCTGGGCGATGGGG + Intronic
928903328 2:36344612-36344634 GAAAGGAGAGGGGAGCGGAGGGG + Intergenic
929268171 2:39942083-39942105 GAAAGGAGAGAAGGGAGATGTGG + Intergenic
932031685 2:68193372-68193394 GAAAGGAGGGGAGGGAGATGAGG - Intronic
932496552 2:72148522-72148544 GGCAGGAGCGGCGGGCGAGGCGG + Intergenic
932812147 2:74834510-74834532 GAGAGGGGAGGCGGGCGGCGCGG - Exonic
934685868 2:96321416-96321438 GAAAGACGAGGCGGGGGACGGGG - Intergenic
935313751 2:101811084-101811106 GAAAGTAGGGTCGGGCGAGGTGG + Intronic
935971492 2:108534382-108534404 GGAAGGCGAGGCGGGCCGCGCGG - Intronic
939218138 2:139266696-139266718 GGAAGGAGAGGCGGGCATTGGGG + Intergenic
939789413 2:146553027-146553049 GAAAGGAGAGGGGAGCAGCGGGG + Intergenic
940635674 2:156293865-156293887 GAATGGAGAGGCGGGAGGGGTGG + Intergenic
941087388 2:161133826-161133848 GAAAGGGGAGGCAGGGGAGGTGG - Intergenic
942071849 2:172323471-172323493 GAAGGGAGAGGCGAGAGACAGGG - Intergenic
942985409 2:182134762-182134784 GAAAGGAGAAGAGGGGGAGGAGG + Intergenic
945103842 2:206289451-206289473 GAGAGGAGAGGTGGGTGAAGTGG + Intronic
945476805 2:210292983-210293005 GAAAGGAAAGGAGGGAGAAGAGG - Intronic
947144999 2:227056080-227056102 GAAAGGACAGCCGGGAGATGTGG - Exonic
947541365 2:230982051-230982073 GAAAGGAGAGGCCTGGGATGTGG + Intergenic
948158132 2:235801095-235801117 GCAAGGGGAGGCTGGGGACGAGG - Intronic
1172051316 20:32121647-32121669 GAATGGAGAGGCGGGAGGGGTGG - Intronic
1174501217 20:50986118-50986140 GAAAAAAGAGGCGGGCGCGGTGG - Intergenic
1174701862 20:52617231-52617253 GAAGGGAGAGGCCGGGGAGGGGG + Intergenic
1174874955 20:54217275-54217297 GAAAGGGGCGGCGGGGGGCGGGG + Intronic
1175199499 20:57267649-57267671 GACAGGAGAGGAGGCCGATGGGG - Intergenic
1177535172 21:22417094-22417116 GAAAAGAGAGACGGGGGAAGAGG - Intergenic
1179885896 21:44314166-44314188 GCAAGGAGTGGGGGGCTACGGGG + Intronic
1180159359 21:45992196-45992218 GAAAGGAGAGGCGGGCGACGAGG + Exonic
1180782398 22:18528595-18528617 GCAAGGGGAGGCGCGCGAGGCGG + Exonic
1180875045 22:19171288-19171310 GAAAGGAGGGGCGGGAGGCCAGG + Intergenic
1181239287 22:21467930-21467952 GCAAGGGGAGGCGCGCGAGGCGG + Intergenic
1184021437 22:41824360-41824382 GAACAGAGAGGCGGGCGGGGTGG + Intronic
951032824 3:17901721-17901743 GAGAGGAGAGGAGGGAGACAAGG + Intronic
956813541 3:72888033-72888055 GAGAGGAGAGGAGGGGGAGGCGG - Intergenic
961321321 3:126078384-126078406 GAAAGGAGAGGAGGAGGACTTGG + Intronic
962420959 3:135228980-135229002 GACAGGAGAGGAGGGTGACCAGG - Intronic
963419131 3:145037161-145037183 GAAAGGGGTGGGGGGCGAGGCGG + Intergenic
966183143 3:177204779-177204801 GAAAGGAGTGGCAGGAGACGGGG + Intergenic
967258606 3:187619418-187619440 GAAAGGAGTGGCGAGAGACAAGG - Intergenic
967813841 3:193782606-193782628 GAATGGAGAGGCGAGTGAGGTGG + Intergenic
968983593 4:3863908-3863930 GACAGGAGATGTGGGCGGCGAGG - Intergenic
969143876 4:5102935-5102957 AAAAGGAGAGGAGGGGGAGGGGG - Intronic
971279916 4:25234328-25234350 GGAGGGCGAGGCCGGCGACGAGG + Exonic
972604705 4:40603544-40603566 GAAAGGAGAGGAGGGAGGAGAGG - Intronic
978503597 4:109433998-109434020 GAACGGTGAGGCGGGCGGCCCGG + Exonic
978777288 4:112516409-112516431 GAAAAGAGAGGCGGGGGTGGTGG - Intergenic
981395345 4:144240785-144240807 GAAAGGAGTGGGGAGGGACGGGG + Intergenic
981859155 4:149333850-149333872 GAAAGCAGAGGTGGGAGTCGGGG + Intergenic
984991392 4:185384901-185384923 GAAAGGGGCGGCGGGGGACGGGG - Intronic
985769350 5:1799401-1799423 GGAAGCAGGGGCGGGCGACCGGG - Intronic
985870797 5:2554845-2554867 GAAAGGAGATGCTGGAGATGGGG - Intergenic
989071341 5:37514727-37514749 GAAAGCAGAGGTGGGCGCAGTGG + Intronic
992374718 5:76176826-76176848 GAAAGTAGAGGCCGGCAAGGTGG + Intronic
993020960 5:82590231-82590253 GAAAGGAGAGGCCAGGGTCGGGG - Intergenic
993373359 5:87119157-87119179 GAAAGGAGAGAAGGGAGAAGAGG + Intergenic
995395306 5:111681109-111681131 GAAAGGAGAGACGGGAGAACAGG - Intronic
996434949 5:123423533-123423555 ACGAGGAGAGGCGGGCGACTTGG + Intronic
998907382 5:146920657-146920679 GAAGGAAGAGGCTGGCTACGGGG + Intronic
1001342634 5:170861955-170861977 GGGAGCAGAGGCGGGCGCCGCGG - Exonic
1002193666 5:177491294-177491316 GAGAGGACAGGAGGGCGAAGTGG + Intronic
1002526087 5:179816890-179816912 GGAGGGAGAGGCTGGCGAGGGGG + Intronic
1002743032 5:181447697-181447719 GAAAGGGTAGCCGGGCGAGGTGG + Intergenic
1004399837 6:15278246-15278268 GAAAGGTGAGCTGGGCGCCGTGG + Intronic
1005859155 6:29888084-29888106 GAGAGGAGCCGCGGGCGCCGTGG + Intergenic
1005905619 6:30259944-30259966 GGATGGAGCGGCGGGCGCCGTGG + Intergenic
1006026252 6:31148843-31148865 GGGAGGGGGGGCGGGCGACGGGG + Intronic
1006042427 6:31267473-31267495 GAATTGAGAGGCGAGGGACGAGG - Intergenic
1006052016 6:31352560-31352582 GAATTGAGAGGCGAGGGACGAGG - Intronic
1006052810 6:31356806-31356828 GAGAGGAGCCGCGGGCGCCGTGG - Exonic
1006340127 6:33442370-33442392 GAAAGGAGAGGCGGGAATGGTGG - Intronic
1006470420 6:34225700-34225722 GAAAGTAGAGGCGGGCAAAGGGG + Intergenic
1006632764 6:35441325-35441347 AAAAGGAGAGGCGGCTGACAGGG - Intergenic
1007341537 6:41194108-41194130 GAAAGGAGGGTCGGGGGAGGAGG - Intronic
1007856325 6:44862067-44862089 AAAAGGAGAGGCGGGGGCTGAGG - Intronic
1008378679 6:50819848-50819870 GGTGGGAGAGGCGGGCGAGGTGG + Intronic
1008378736 6:50820075-50820097 GGAAGTCGAGGCGGGCGAAGCGG + Intronic
1012182713 6:96175267-96175289 GGAAGGAGAAGCAGGTGACGGGG - Intronic
1014521291 6:122445560-122445582 GAAGGGAGGGGCGGGGGAGGGGG - Intronic
1015526702 6:134181053-134181075 GAATGGAGAGGAGGCCGACCAGG - Intronic
1015605037 6:134945589-134945611 GAAAGGAGAGGAGTGAGACATGG - Intronic
1017443897 6:154489982-154490004 GAATGGAGAGGAGGGAGACTGGG - Intronic
1018774002 6:166998156-166998178 GAAAGGAGCAGCGGGAGCCGCGG - Intergenic
1019248132 6:170723120-170723142 GAAAGGGTAGCCGGGCGAGGTGG + Intergenic
1019479654 7:1260592-1260614 GAGAGGGGAGGTGGGCGCCGAGG - Intergenic
1019628150 7:2031836-2031858 GAAAGGAGAGCAGGGCAACGTGG + Intronic
1019628646 7:2034765-2034787 GAAAGGAGAGAAGGGAGACGTGG + Intronic
1029577763 7:101414722-101414744 GAAAGGTGAGCCGGGCGCAGTGG - Intronic
1029628200 7:101733722-101733744 GAAAGGAGATGCCGGCCAAGTGG + Intergenic
1031214862 7:118877255-118877277 GAAAGAAGAGGAAGGGGACGGGG + Intergenic
1031595052 7:123640620-123640642 GAGAGGAGAGGAGGGGGAGGGGG + Intergenic
1031866057 7:127039829-127039851 GAAGGGAGAGGAAGGGGACGGGG + Intronic
1034339100 7:150340981-150341003 GAAAGGAGAGAGGGGCTCCGGGG - Exonic
1034437112 7:151067996-151068018 GGAAGGAGAGGGAGGCCACGTGG - Exonic
1035412679 7:158657702-158657724 GAATGGAGAGGCGGGAAAGGTGG + Intronic
1037000603 8:13714073-13714095 GAAGGGAGAGCTGGGCGATGAGG - Intergenic
1038613172 8:29071900-29071922 GAACGGGGAGCCGGGCGCCGGGG + Exonic
1039476645 8:37842352-37842374 CTAAGGTGGGGCGGGCGACGCGG + Exonic
1039875155 8:41578505-41578527 GAGCGGAGAGGCGGGCGGCCGGG - Intronic
1042307038 8:67343375-67343397 GAAAGGAGAGGGGGTGGAGGTGG + Exonic
1042346585 8:67733748-67733770 GAAAGGAGTGGGGGGCGGTGGGG + Intronic
1044542142 8:93420012-93420034 GAAAGGAGAGGAGAGAGAAGGGG - Intergenic
1044662045 8:94600945-94600967 GAAAGGAGAGGGGAGGGAAGGGG + Intergenic
1045757961 8:105568328-105568350 GAAAGGAGAGGCAGAGGACTAGG - Intronic
1046146120 8:110160810-110160832 GGAAGGAGAGGAGGGAGAGGAGG + Intergenic
1047907487 8:129488047-129488069 GAAAGGATAGCCGGGCGCAGTGG + Intergenic
1049321546 8:141999499-141999521 GAAAGGAGCGGCGGGCAGCAAGG - Intergenic
1051792481 9:20822427-20822449 GAAAGGAGAGGAAGGGGAGGAGG + Intronic
1053506394 9:38646923-38646945 GAAAGGAGAGCCGGGCGCGGTGG - Intergenic
1054460315 9:65458867-65458889 GAAGGGAGAGGGGTGTGACGCGG - Intergenic
1057439621 9:95073459-95073481 GAAAGAAGAGGCCGGCGCGGTGG + Intronic
1057547197 9:96027397-96027419 GAAAGGAGAGGGCAGCGACTGGG + Intergenic
1058022494 9:100103670-100103692 GAAAGGAGAGGCGAGGGGAGGGG + Intronic
1059165691 9:112074432-112074454 GAAAGCAGGGGCTGGCGAGGGGG - Intronic
1059636624 9:116177853-116177875 GAAAGAAGAGGTGGGGGATGGGG - Intronic
1060272905 9:122159715-122159737 TCAAGGAGACGGGGGCGACGCGG - Exonic
1060597160 9:124855529-124855551 GTGAGGGGAGGCTGGCGACGAGG + Intronic
1061306521 9:129736003-129736025 GAAAGGAGGGGCAGGGGTCGGGG - Intergenic
1061405935 9:130393116-130393138 GACAGGAGAGGCTGGCTGCGTGG - Intronic
1061737404 9:132670664-132670686 GGAGGGAGAGGGGGGCGGCGAGG + Exonic
1062105747 9:134753873-134753895 GAAGGGCGAGCCGGGAGACGTGG + Exonic
1062153702 9:135034239-135034261 GAGAGGAGAGGCAGGGGATGGGG - Intergenic
1062153736 9:135034346-135034368 GAGAGGAGAGGCAGGGGACGGGG - Intergenic
1203608538 Un_KI270748v1:75995-76017 GAAAGGAGAGGGGGGTGGAGAGG + Intergenic
1203608914 Un_KI270748v1:78732-78754 GAAAGGGTAGCCGGGCGAGGTGG + Intergenic
1187055525 X:15738369-15738391 GAGAGGAGTGGGGGGCGACCAGG + Intronic
1187521252 X:20016177-20016199 GAAAAGAAAGGCAGGCGAGGAGG - Exonic
1189988720 X:46575314-46575336 CAGCGGAGAGGAGGGCGACGCGG + Exonic
1192149681 X:68704474-68704496 GAAAGGAGAGGCTGGAGGCTGGG + Intronic
1193291305 X:79776548-79776570 GAAAGTAGAGCCGGGCGCGGTGG - Intergenic
1194637744 X:96366288-96366310 GAAAGGATGGGAGGGGGACGAGG - Intergenic
1195306298 X:103586474-103586496 GGGAGGAGTGGCGGGCTACGTGG + Intronic
1196065438 X:111459092-111459114 GACAGAAGAGGCGGACGAGGTGG - Intergenic
1196085844 X:111681590-111681612 GGAAGGAGGGGCGGAGGACGCGG - Intronic
1196819992 X:119694078-119694100 AAATGGAGGGGCGGGTGACGGGG + Intergenic
1197990214 X:132309498-132309520 GAAGGGAGAGGAGGGAGACCAGG + Intergenic
1199770633 X:150973174-150973196 GAAAAGAGAGGCAGGCAATGTGG + Intergenic
1200049386 X:153420724-153420746 GCAAGGAGGGGCAGGCGGCGAGG + Exonic
1202378658 Y:24258900-24258922 GACAGGAGAGCCTGGCGGCGGGG + Intergenic
1202492124 Y:25411221-25411243 GACAGGAGAGCCTGGCGGCGGGG - Intergenic