ID: 1180160446

View in Genome Browser
Species Human (GRCh38)
Location 21:45996776-45996798
Sequence GCCCCAGCTCCCACCTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180160446_1180160451 4 Left 1180160446 21:45996776-45996798 CCCTCAAAGGTGGGAGCTGGGGC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1180160451 21:45996803-45996825 TCTGGAAATAGACCCCCACAGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1180160446_1180160457 21 Left 1180160446 21:45996776-45996798 CCCTCAAAGGTGGGAGCTGGGGC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1180160457 21:45996820-45996842 ACAGGGTCCTCATGAGATGTGGG 0: 1
1: 0
2: 0
3: 17
4: 148
1180160446_1180160459 23 Left 1180160446 21:45996776-45996798 CCCTCAAAGGTGGGAGCTGGGGC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1180160459 21:45996822-45996844 AGGGTCCTCATGAGATGTGGGGG 0: 1
1: 0
2: 2
3: 46
4: 463
1180160446_1180160450 3 Left 1180160446 21:45996776-45996798 CCCTCAAAGGTGGGAGCTGGGGC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1180160450 21:45996802-45996824 CTCTGGAAATAGACCCCCACAGG 0: 1
1: 0
2: 0
3: 12
4: 117
1180160446_1180160456 20 Left 1180160446 21:45996776-45996798 CCCTCAAAGGTGGGAGCTGGGGC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1180160456 21:45996819-45996841 CACAGGGTCCTCATGAGATGTGG 0: 1
1: 1
2: 3
3: 22
4: 232
1180160446_1180160458 22 Left 1180160446 21:45996776-45996798 CCCTCAAAGGTGGGAGCTGGGGC 0: 1
1: 0
2: 3
3: 23
4: 203
Right 1180160458 21:45996821-45996843 CAGGGTCCTCATGAGATGTGGGG 0: 1
1: 0
2: 1
3: 11
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180160446 Original CRISPR GCCCCAGCTCCCACCTTTGA GGG (reversed) Intronic
901438190 1:9262320-9262342 GCCCCAGGGCCCACCTGCGAAGG - Exonic
901769784 1:11524371-11524393 GACCCAGCACCCACCTCTGAGGG - Intronic
901989422 1:13100700-13100722 CCCACAGCTCCCACCTTCGATGG - Intergenic
901992391 1:13126064-13126086 CCCACAGCTCCCACCTTCGATGG + Intergenic
902164376 1:14558161-14558183 GGCCCAGCTCCTCTCTTTGAAGG + Intergenic
903154700 1:21435850-21435872 GCCCCAGGTCACACAGTTGATGG - Intergenic
903807028 1:26012886-26012908 CCCTCAGCTCCCACCTCTGCTGG + Intergenic
904837334 1:33347870-33347892 GCCCCAGTTCCCGCCTTGCAGGG + Intronic
905956032 1:41996886-41996908 GCCCCTTCTACCATCTTTGAAGG + Intronic
907592680 1:55690744-55690766 CACCCAGCTCCCTCCTTTTATGG + Intergenic
908230581 1:62100796-62100818 GCGCCACCTCCCATCCTTGATGG - Intronic
908702851 1:66920686-66920708 ACTCCAGTTCCCACCTGTGAAGG + Intronic
912836377 1:113000001-113000023 GCCCCAGCCCCCAGCTTCCAGGG - Intergenic
915311795 1:155008857-155008879 GCTCCAGCTCCCTCCTTCAAAGG - Intronic
916784483 1:168075700-168075722 ATCCAAGCTCCCACATTTGAAGG - Exonic
918113308 1:181476802-181476824 GCCCCAGCTCCCACTGATGGGGG - Intronic
919810558 1:201406600-201406622 GCCCCAGCTCCCAGCTCTACTGG + Exonic
920280935 1:204843111-204843133 GCCCCAGCTGCAACTTTTTATGG - Intronic
920422300 1:205843376-205843398 CCCCCAACCCCCACCTTGGAAGG + Intronic
920436701 1:205951552-205951574 GCCGGAGCTCCAACCCTTGAGGG + Intergenic
920875406 1:209829770-209829792 GCCACCGCTCCCAGCTTAGAGGG + Intronic
922524375 1:226288256-226288278 GCCACAGCGCCCAGCTTAGATGG + Intronic
923276094 1:232397705-232397727 ACCCCACCTCCTACCTATGAAGG + Intergenic
1068727140 10:60316191-60316213 GCCCCAGAGCCTGCCTTTGATGG - Intronic
1069756068 10:70775082-70775104 CCCTCAGCTCCCACCCTGGAGGG - Intronic
1071351715 10:84753159-84753181 GCCCAAGATCCCAACTATGAAGG + Intergenic
1072239560 10:93482936-93482958 CGCCCAGCTCTCACCTCTGAAGG - Intergenic
1072314280 10:94186971-94186993 GCCATGGCTCCCACCTTTCAGGG - Intronic
1073136340 10:101222581-101222603 GCCCCAGCTCGTCCCTTTCAGGG + Intergenic
1075451895 10:122557430-122557452 CTCCCACCTCCCACCTCTGAGGG - Intergenic
1076896138 10:133313274-133313296 ACCCCATCACCCACCTCTGAGGG - Intronic
1076983160 11:216008-216030 GGCCCAGCTCCTCCCTCTGAAGG - Exonic
1077404243 11:2375778-2375800 GACACAGCTCACACCTTTAACGG + Intergenic
1078068209 11:8091773-8091795 GCCCCAGCCCCACCCTTTGCTGG + Intronic
1078449705 11:11431404-11431426 GGCTCAGCTCCCATCTCTGATGG - Intronic
1078996039 11:16700843-16700865 AACCCTGCTCACACCTTTGAAGG + Intronic
1079476916 11:20840768-20840790 GACACAGTTCCCACCTTTCAAGG + Intronic
1081604442 11:44518579-44518601 GCCCCAGGTCACACCTTTAGAGG - Intergenic
1082001828 11:47397323-47397345 GCCCCAACTCCCACCTTGGCAGG + Intergenic
1082727422 11:56752764-56752786 TCTCCAGCTCCCACCTCTGAGGG - Intergenic
1083544600 11:63538908-63538930 CCCCCAGCTCCCAGCACTGAGGG - Intronic
1084072146 11:66743771-66743793 CTCCCAGGTCCCACCTTTGCGGG + Intergenic
1085200204 11:74697191-74697213 GCCCAAGCTCCTACCTTCGTGGG + Exonic
1088585417 11:111356478-111356500 GTCCCAGAGCCCACCTTCGATGG - Intronic
1088597999 11:111454227-111454249 CTCCCAGCTCCCACCTGTGGGGG - Exonic
1089159131 11:116424225-116424247 TCCCCAGCTGCCAGCTTTTAAGG - Intergenic
1089457040 11:118631756-118631778 CCCGCAACCCCCACCTTTGAGGG - Intronic
1090003415 11:122980747-122980769 GCCCCAGCTGCCAGCATTGCTGG - Intronic
1090310374 11:125731359-125731381 GGCCCACCTCCCACCATTCAGGG - Intergenic
1092679995 12:10968625-10968647 GCCCCAGTTCCCTCCCATGAAGG - Intronic
1096214515 12:49791976-49791998 GCCCCAGGGCCCACCTTTCGGGG - Exonic
1102517288 12:113458296-113458318 GCCCCAGGTCCCACCACTTATGG - Intergenic
1102521949 12:113483421-113483443 GCCTCAGTTTCCACATTTGAGGG + Intergenic
1102650150 12:114436179-114436201 GCCCCAGCTCCTACGTTTAAGGG + Intergenic
1103305809 12:119963063-119963085 GCCTCAGCTACTACCTTTGCTGG + Intergenic
1104051854 12:125200153-125200175 TCCCCAGCCCCCACCTTAGAAGG - Intronic
1104197830 12:126558148-126558170 CCCCCAGCTCCCACCTGTGTGGG - Intergenic
1104485756 12:129150122-129150144 GCCCCAGCACCCACATATGTGGG - Intronic
1104579628 12:130001204-130001226 CCCCCACCACCCACCTCTGATGG - Intergenic
1105987302 13:25580445-25580467 AACCCAGCTCCCACACTTGAAGG - Intronic
1108660974 13:52586047-52586069 CACCCAGCTCTCACATTTGAGGG - Intergenic
1112291143 13:98144325-98144347 GCCTCAGCTCCCTCCTTTCTGGG - Intronic
1112303062 13:98247686-98247708 ACCCCAGCTTCCACCTTCAACGG + Intronic
1114618584 14:24081666-24081688 GCCCCGGCTCCCACCTTCACCGG + Intronic
1119694474 14:76701719-76701741 GCCCCAACCTCCATCTTTGAAGG - Intergenic
1121323772 14:93007916-93007938 GTGCCAGCTCCCCTCTTTGATGG - Intronic
1121411001 14:93748316-93748338 GCCCCAGGGCCAACCTGTGACGG + Intronic
1122849493 14:104519858-104519880 GTCCCAACTCCCACCTGTGGAGG + Intronic
1126197886 15:45952220-45952242 GCCCCAGCTGCCCCCTTTAGGGG + Intergenic
1130299116 15:82666733-82666755 ATTTCAGCTCCCACCTTTGAAGG + Exonic
1130927862 15:88398608-88398630 GGCCCAGCTTCCACCCTTGAGGG + Intergenic
1132690901 16:1181368-1181390 GGCTCAGCTCCCACCGTTGCCGG - Intronic
1132939610 16:2500321-2500343 GACCAAGCCCCCACCCTTGATGG + Exonic
1134202994 16:12214276-12214298 GCCTCAGCTCCCTCCTCGGAAGG + Intronic
1134559738 16:15198097-15198119 GCCTCAGCTCTCCACTTTGATGG - Intergenic
1134920277 16:18109708-18109730 GCCTCAGCTCTCCACTTTGATGG - Intergenic
1137391313 16:48083581-48083603 GCCCCAGCTCACTCCGTGGATGG + Exonic
1138454472 16:57113478-57113500 GCCCCTGCTCCCACCCAGGAGGG - Intronic
1138625742 16:58250053-58250075 GCTCCAGCTCCGACCCTTCATGG - Exonic
1139551314 16:67674657-67674679 GCCCCAGTCCCCACCTGGGAAGG + Exonic
1141393120 16:83681146-83681168 ACCCCAGCACCCAGCTGTGAGGG + Intronic
1141436467 16:84002499-84002521 GCCCCTGCCCCCACCTGAGAAGG + Exonic
1142979308 17:3662567-3662589 GCCTCAGCTCCCACCTGGGAGGG - Intergenic
1143281971 17:5761524-5761546 TCTCCAGTTCCCACCTGTGATGG + Intergenic
1144396239 17:14846003-14846025 GAGCCAGCTCCCACCTGTGCAGG + Intergenic
1147956450 17:44138027-44138049 CCCCCAGCCCCCAGCCTTGAGGG + Intergenic
1149226638 17:54478952-54478974 GCCCCTGCTCTCACCTGTGAAGG - Intergenic
1150135571 17:62693140-62693162 GGCCCAGCTCCCACCCTGGGAGG - Exonic
1152118087 17:78401049-78401071 GCCCAAGCTCCCACCTTTCTGGG - Intronic
1152746683 17:82043595-82043617 CCCCCAGCTCCCATCTTCCACGG + Intergenic
1155160571 18:23192337-23192359 GCCTCAGCTCCTTCCTTTGCTGG + Intronic
1160445899 18:78926450-78926472 CACCCTGCTCCCACCTTTGAGGG - Intergenic
1160514148 18:79469418-79469440 CCGCCACCTCCCACCTGTGAAGG - Intronic
1162785542 19:13032535-13032557 GTCCCAGATTCCGCCTTTGAAGG + Intronic
1163015556 19:14451894-14451916 GTCCCAGGTCCCCCCATTGAGGG - Exonic
1163164085 19:15483452-15483474 GCCCCAACTCCAAGCTTTAAAGG - Intronic
1163746545 19:19052187-19052209 CCCCCAGCTCTTACCTTTGGTGG - Exonic
1164312902 19:24061700-24061722 GGCCCAGCTCACAGGTTTGATGG + Intronic
1165970510 19:39624811-39624833 GCCACAGCTCCCAGCCTTGTTGG - Intergenic
1166120472 19:40683364-40683386 GCCCCAGCTCCCTCATCTGCAGG + Intronic
1166369077 19:42291458-42291480 GGCCCAGGTCTCACCTTTGGGGG - Exonic
1167040625 19:47020839-47020861 GCCTCAGCTCCCACCCTAGCCGG - Intronic
926119484 2:10234488-10234510 TCCCCAGCTCCCAGCAATGAGGG + Intergenic
927576834 2:24207650-24207672 GCCCCAGCTCCCTGCACTGATGG - Intronic
927703092 2:25280335-25280357 ACCCCGGCAGCCACCTTTGAAGG + Intronic
927758127 2:25725111-25725133 GCCCCACCTCCCTCCTGAGAAGG - Intergenic
929455349 2:42061153-42061175 GCCCCACCTCCCGCAGTTGAAGG - Intergenic
933760520 2:85668848-85668870 GCCCCAGCCCCTACCCTGGAGGG - Intergenic
933973511 2:87489454-87489476 GCCCCAGCTCCTGCCTCTGTTGG - Intergenic
935080421 2:99787608-99787630 GCCCCAGCTCAGACCTCTGCAGG - Intronic
936320214 2:111460759-111460781 GCCCCAGCTCCTGCCTCTGTTGG + Intergenic
937228116 2:120381461-120381483 CCCCAAGCTCCCACCTGTAAAGG + Intergenic
939591813 2:144073774-144073796 CCCCCAACTCCCAACCTTGATGG + Intronic
942812374 2:180014187-180014209 GCCCCACCTCCAACCTTGGTCGG - Intergenic
943013305 2:182478774-182478796 GCCCCAGATCCCATATTTGGAGG + Intronic
943514703 2:188869833-188869855 TCCCCTGCTCCCACCTATGGAGG + Intergenic
946186484 2:217983534-217983556 GCCCCAGCTCCCACCCCAGCTGG + Intronic
948113919 2:235479669-235479691 GCCCCAGCCCCCTTCTCTGATGG - Intergenic
948358015 2:237395898-237395920 CCCTGAGCTCCCACCCTTGAGGG - Intronic
948765779 2:240217947-240217969 GTCTCAGATCCCACCTGTGAGGG + Intergenic
1171025984 20:21630662-21630684 TCACCAGCTCCCTGCTTTGATGG - Intergenic
1174057154 20:47806035-47806057 ACTCCAGGTCCCACCTGTGAAGG - Intergenic
1174577409 20:51546342-51546364 GCCCAAACTCCCACCCTTCAAGG - Intronic
1175424057 20:58853340-58853362 GCCCGAGCAACCACCTTTGGAGG + Exonic
1176659952 21:9624739-9624761 GCCCCAAATCCCTCCTTTTAAGG - Intergenic
1179823245 21:43949448-43949470 GCCCAAGCCACCACCTCTGATGG + Intronic
1180160446 21:45996776-45996798 GCCCCAGCTCCCACCTTTGAGGG - Intronic
1180741493 22:18056143-18056165 GCCCCAGCCTCCACTTTTCAAGG - Intergenic
1180972640 22:19823334-19823356 GCCCCTGCTCCAGCCTGTGATGG + Intronic
1182345676 22:29662777-29662799 GCCACAGCCCCCGCCTTTCAGGG + Intronic
1183213557 22:36465427-36465449 GCTCCAGCTCCCTCCTTAAAAGG - Intergenic
1184291755 22:43501111-43501133 GCCTCCGCTTCCACCTGTGAGGG - Intronic
1184650633 22:45918073-45918095 GCCTCAGCTCCCACCCTTAGGGG - Intergenic
1184821186 22:46910323-46910345 GTCCCAGGTCCCTCCTTTGTAGG + Intronic
1185315733 22:50178394-50178416 GGCCCTGCCCCTACCTTTGATGG - Exonic
950196796 3:11014996-11015018 GGCGCAGCTCCCAGCTCTGAGGG + Intronic
950444458 3:13028301-13028323 GCCCCAGATCCCACCCTGGCAGG - Intronic
951588372 3:24237743-24237765 GCCCCAGAACCCAGCATTGAAGG - Intronic
952223199 3:31345885-31345907 CCCCCAGCTCCCATCTATGGAGG - Intergenic
952969428 3:38641547-38641569 TCCTCAGCTCCCACCTCTGGAGG - Intronic
953784916 3:45904083-45904105 GCCCAGGCTCCCACCTGGGAAGG - Intronic
953810625 3:46109439-46109461 CTCCCAGCTGTCACCTTTGATGG + Intergenic
954422015 3:50423828-50423850 TCCCCACCTCCCATCTCTGAGGG - Intronic
954675671 3:52314079-52314101 GCCCCCACTCCCACCTTCCAGGG - Intergenic
960887775 3:122414180-122414202 CACCCCACTCCCACCTTTGAAGG - Exonic
961326658 3:126113108-126113130 GCCCCAACTCCCACCACTGGAGG + Intronic
964315920 3:155444222-155444244 CCCCAAGCTCCCAACTTTAAGGG + Intronic
965579253 3:170249673-170249695 GATTCAGCTCCCACCTTGGAAGG + Intronic
966898893 3:184466262-184466284 CCCTCAGCTCCCACCTCTGTCGG - Intronic
968071934 3:195789472-195789494 GCCCCAGCTCCCACCGGGGATGG - Exonic
968289297 3:197526347-197526369 GCCCCGGATCCAACCTTGGAAGG - Intronic
968549129 4:1213464-1213486 GCCCCCACGCCCACCTGTGATGG + Exonic
968749293 4:2378923-2378945 GCACCAGCTTCCACCCTTGTGGG - Intronic
968769146 4:2492728-2492750 GCTCCAGGGCCCACTTTTGATGG + Intronic
968912991 4:3485261-3485283 ACCCCAGCGCCCAAGTTTGAAGG + Intronic
969646900 4:8435909-8435931 GCCCCAGGTCTCACCTTGAAGGG + Intronic
969703057 4:8778173-8778195 GCACCAGCCCCCTCCTTTGCTGG - Intergenic
975895598 4:79086277-79086299 CCCCCAGCTACCTCCTTTCATGG - Intergenic
976209513 4:82653387-82653409 GCCCGAGCTCCCACATTAGAAGG + Intronic
978723323 4:111940900-111940922 GCCCCAGCTCCCAACCTTGATGG + Intergenic
979719755 4:123884983-123885005 TCCACAGTTCCCACCTTTCATGG + Intergenic
982053322 4:151525423-151525445 GCTCTACCTCCCACCTTTGCTGG - Intronic
982817812 4:159908146-159908168 GCCACAGCTCCAGCCTTGGAAGG - Intergenic
983484527 4:168318321-168318343 TACCCAGCTCCCACCTTTGACGG + Intronic
985415422 4:189731667-189731689 GCCCCAAATCCCTCCTTTTAAGG + Intergenic
987054586 5:14179185-14179207 GCCCCACCCCCCACCTTTGTGGG + Intronic
987343213 5:16956557-16956579 GCCCCTGCACCCACCCTTGCTGG - Intergenic
987794036 5:22605526-22605548 TTCCCACCTCCCACCTCTGAAGG + Intronic
991939711 5:71838755-71838777 GCCCCGTCTGCCACCTCTGAGGG - Intergenic
992323137 5:75633919-75633941 ATCCTAGCTCCCACCTTTGTGGG - Intronic
995798365 5:115963956-115963978 GCCCAAGGACCAACCTTTGAGGG - Intronic
997863895 5:137444097-137444119 GACCTAGCTTCCACCTGTGAGGG + Intronic
997949417 5:138230415-138230437 TCCCCAGCTCCTGCCTCTGAAGG + Intergenic
998607141 5:143647059-143647081 TCCCCAGCTCCTTCCTCTGAAGG - Intergenic
999109308 5:149104168-149104190 GCTCCAGCTCCCCACTTTTAGGG - Intergenic
1002449491 5:179310761-179310783 GCCTCTACACCCACCTTTGAGGG - Intronic
1002842225 6:915962-915984 GCCCAAGCCCCCACCTTTCTAGG + Intergenic
1003004039 6:2364146-2364168 GCCCCTGCTTCTAACTTTGATGG - Intergenic
1003130692 6:3392987-3393009 GCCCCAGATCCAACCTTTGGAGG + Intronic
1003315898 6:5011547-5011569 GCCCCAGCTCCCGCCTGTGAGGG - Intergenic
1007243314 6:40442526-40442548 GCCCCAGCTCCACCCTCAGAGGG - Intronic
1009373842 6:62942854-62942876 TCCAAAGCCCCCACCTTTGAAGG + Intergenic
1017291659 6:152744825-152744847 CCCCCAGCTCCCGCCTCTGCTGG - Intergenic
1018640441 6:165899662-165899684 GCCCCAGGTACCACCCTTTAGGG - Intronic
1019273037 7:161240-161262 GCCCCAGGTCACACCCGTGAGGG + Intergenic
1019649982 7:2151634-2151656 ACCCCAGCTCCCAGCTTTGCTGG - Intronic
1019984879 7:4648320-4648342 GCTCCAGCTCCCTCCATGGACGG - Intergenic
1021525018 7:21577353-21577375 GCTCCAACTCCCACCCTTGCTGG + Intronic
1022004580 7:26255630-26255652 GCCCCAGCTCTCACTTTGGTGGG + Intergenic
1022473048 7:30693394-30693416 GCCCCCAATCCCACCTTTGAGGG - Intronic
1023882475 7:44328118-44328140 TCCCCAGCTGCCACCTGGGAGGG - Intronic
1023937450 7:44749526-44749548 CCCCCAGCTGCCAGTTTTGATGG + Intronic
1025849403 7:65233647-65233669 ACTCCAGTTCCCACCTGTGAAGG + Intergenic
1029164532 7:98577897-98577919 GCTCCAGCTCTCACCTCTGATGG - Intergenic
1030297522 7:107943864-107943886 GCTCCAGCTCCACCTTTTGAAGG - Intronic
1033535992 7:142312678-142312700 GCACCAGCTCCCATCATTCAAGG - Intergenic
1033655391 7:143370171-143370193 ATTCCAGCTCCCACCTTAGAAGG - Intergenic
1034121725 7:148634303-148634325 GCCCCAGGCCCCACCTCGGATGG + Intergenic
1035680535 8:1484227-1484249 GCCACAGCTCTCAGCTTTGCAGG + Intergenic
1035889654 8:3329608-3329630 GCCTGAGCTCCAACCTGTGAAGG - Intronic
1038283217 8:26184051-26184073 GCCCCAGCTCACAGCTTTTGGGG + Intergenic
1038520815 8:28230585-28230607 GCCTCGGCTAGCACCTTTGATGG - Intergenic
1039436340 8:37561956-37561978 GCCCCAGTTGCCAGCTTCGAGGG + Intergenic
1040285522 8:46098639-46098661 GGCCCAGCTGCCATCTGTGAGGG - Intergenic
1040291209 8:46125979-46126001 GCCCCAGGTCTCACCTTGAAGGG + Intergenic
1040787238 8:51179992-51180014 GCCTCAGCTCCTGCCTTTTAGGG + Intergenic
1041143366 8:54845520-54845542 GCCCGAGCTGCCACTTCTGAGGG - Intergenic
1045242265 8:100412923-100412945 CCCCCAGCACACACCTTTTAAGG + Intergenic
1049236672 8:141515590-141515612 GCCCCAGCTCCTGCCCTCGAGGG + Intronic
1049991818 9:998445-998467 GCCGCACCTCCCACCTCTCATGG - Intergenic
1051538638 9:18189189-18189211 TCCCCAGCTCCCACCTCAGTTGG - Intergenic
1051689459 9:19694945-19694967 TCCCCAGCTCCCATCTTTGCCGG - Intronic
1056983442 9:91338859-91338881 CCTCCAGTTCCCACCCTTGAGGG - Intronic
1059886195 9:118747261-118747283 GCCACAGCTCCCAGCCCTGAGGG + Intergenic
1061515513 9:131087709-131087731 AGCCCAGCACCCACCTTTCAGGG - Exonic
1062197924 9:135284920-135284942 GCCCCAGCTGCCTCCCCTGATGG + Intergenic
1062354998 9:136157774-136157796 GCCCCAGCTCCCCCCTCTGTAGG - Intergenic
1062368476 9:136223766-136223788 GCAACAGCTCCTACCTTGGACGG - Exonic
1062585071 9:137245504-137245526 GGGCCAGCTCCCACCCTTGGAGG - Exonic
1203637515 Un_KI270750v1:126583-126605 GCCCCAAATCCCTCCTTTTAAGG - Intergenic
1185838633 X:3368389-3368411 GCCCCAGCTCCCACTTGTATAGG - Intergenic
1186087297 X:6004044-6004066 ACTCCAGTTCCCACCTGTGAAGG + Intronic
1187270496 X:17775884-17775906 GCCCCAGCTCCCACCCCCGATGG - Intergenic
1187320012 X:18229841-18229863 GCCCCAGCTCCCTCCCCCGACGG + Intergenic
1190113388 X:47609671-47609693 GCCCCACCTCCCACTACTGATGG - Intronic
1190550408 X:51573917-51573939 GCCCCATCTTCCACCCTTAATGG - Intergenic
1191141805 X:57122151-57122173 GTCCCATCTCCCATTTTTGAGGG + Intergenic
1191786155 X:64919041-64919063 GCAGCAGCCCCCACCTATGAAGG - Exonic
1199337113 X:146630919-146630941 ACTCCAGTTCCCACCTGTGAAGG + Intergenic
1202062723 Y:20904461-20904483 GCCCCAGATCCCATCTCTCAGGG - Intergenic