ID: 1180160596

View in Genome Browser
Species Human (GRCh38)
Location 21:45997284-45997306
Sequence CCCCCTGCACTGATGGGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 173}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180160581_1180160596 28 Left 1180160581 21:45997233-45997255 CCAGGCCCTTCGTGCAGGCCCTT 0: 1
1: 0
2: 1
3: 15
4: 167
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160580_1180160596 29 Left 1180160580 21:45997232-45997254 CCCAGGCCCTTCGTGCAGGCCCT 0: 1
1: 0
2: 1
3: 13
4: 200
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160582_1180160596 23 Left 1180160582 21:45997238-45997260 CCCTTCGTGCAGGCCCTTCGTCA 0: 1
1: 0
2: 0
3: 0
4: 50
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160584_1180160596 10 Left 1180160584 21:45997251-45997273 CCCTTCGTCAGACCCAAGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 285
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160586_1180160596 9 Left 1180160586 21:45997252-45997274 CCTTCGTCAGACCCAAGAGTGGG 0: 1
1: 0
2: 1
3: 9
4: 106
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160590_1180160596 -3 Left 1180160590 21:45997264-45997286 CCAAGAGTGGGCCTGGCTCTCCC 0: 1
1: 0
2: 3
3: 28
4: 246
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160589_1180160596 -2 Left 1180160589 21:45997263-45997285 CCCAAGAGTGGGCCTGGCTCTCC 0: 1
1: 0
2: 2
3: 12
4: 210
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173
1180160583_1180160596 22 Left 1180160583 21:45997239-45997261 CCTTCGTGCAGGCCCTTCGTCAG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG 0: 1
1: 0
2: 0
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180160596 Original CRISPR CCCCCTGCACTGATGGGACT GGG Intronic
903625207 1:24725422-24725444 CCTCCTGCAGGGATGGGGCTTGG - Intergenic
903644573 1:24886823-24886845 CCCTCAGCACTGATGGGAGACGG - Intergenic
903821144 1:26103458-26103480 CCCCCTGCAGAAATGGGGCTGGG + Intergenic
907311635 1:53542171-53542193 TCCCCTTCCCTGATGGGCCTCGG + Intronic
923426626 1:233876574-233876596 ACACCTGCACTGCTGGGACAAGG + Intergenic
924831939 1:247605574-247605596 CCCCCTGGAGGGATGGGATTGGG + Exonic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1064350323 10:14570318-14570340 CACCCTGCCCTGCTGGGCCTTGG - Intronic
1064970528 10:21061816-21061838 TCCCCTGCAGTGATTGTACTTGG + Intronic
1067082797 10:43221136-43221158 CCCTCTGCTCTGAAGGAACTTGG + Intronic
1068369717 10:56096414-56096436 CCTCCTGCATTGATCTGACTAGG + Intergenic
1070025786 10:72630446-72630468 TCCCCTGCAATGATAGGATTGGG + Intergenic
1070144245 10:73762158-73762180 CCCCCTGCACTTACTGGACTAGG - Intronic
1070622693 10:78025966-78025988 CCCCCTGCACATATTAGACTAGG - Intronic
1071121328 10:82282336-82282358 TCACCTGCACTGATGTGATTGGG + Intronic
1072704933 10:97674324-97674346 CCCACAGCACTGATGGGAGATGG - Exonic
1073394640 10:103207900-103207922 GTCCCTGCACAGATGGGACATGG - Intergenic
1073758211 10:106603594-106603616 CCCCCTGCAGTGAAAGAACTGGG - Intronic
1075384866 10:122048303-122048325 ACCCCTGCAGCCATGGGACTGGG + Intronic
1076812975 10:132898779-132898801 GCCCCCGCAGTGCTGGGACTTGG + Intronic
1076987540 11:249648-249670 CCCCTTGCACTGAGGTGAATTGG - Intronic
1077292679 11:1805741-1805763 CTCCCTACACTGGTGTGACTCGG - Intergenic
1077411319 11:2405208-2405230 CTGCCTGCACTCCTGGGACTAGG + Intronic
1081159726 11:39736740-39736762 GTCCCTGCACAGATGGGACACGG - Intergenic
1081741357 11:45443248-45443270 CTCCATGCACTGATGGCTCTGGG + Intergenic
1083202796 11:61130673-61130695 CCCCCTGCACTGTGGGGTTTGGG - Exonic
1083681637 11:64354293-64354315 CCCCCTGCCCTGATGCCACCAGG + Intronic
1089097455 11:115931136-115931158 TCCCCTGCTGTGATGGGAATGGG - Intergenic
1089170674 11:116509266-116509288 ACCCCTGCCCTCATGGGGCTTGG - Intergenic
1089953322 11:122549286-122549308 GTCCCTGCACAGATGGGACATGG - Intergenic
1090510984 11:127374823-127374845 CCTCCTGCACGGGTTGGACTTGG + Intergenic
1090857414 11:130622592-130622614 CCCCCTGCAATGAAGGGGTTGGG - Intergenic
1094144795 12:27216956-27216978 CCTCCTGCAGTGAAGGGATTGGG - Intergenic
1100387344 12:94115890-94115912 ACCCCTGCACTCCTGTGACTGGG + Intergenic
1102203247 12:111072763-111072785 CTCCCTGCCTTGATGGGGCTGGG - Intronic
1102318163 12:111906736-111906758 CCCCATGGACTGCTGGGGCTGGG + Intergenic
1102932581 12:116874019-116874041 CCCCTGGCACTGAGGGGAGTGGG + Intronic
1104257627 12:127154128-127154150 GTCCCTGCACAGATGGGACAGGG - Intergenic
1105032235 12:132892043-132892065 GTCCCTGCACAGATGGGACACGG - Intronic
1106582296 13:31028698-31028720 CCCCCTGGACTCCTGGGGCTTGG + Intergenic
1107065972 13:36214603-36214625 CCCCCTGCACTAATGGCTCCTGG + Exonic
1108803023 13:54122634-54122656 CCACCTGCAGTGCTGGGATTGGG + Intergenic
1112993570 13:105544601-105544623 CCCCACTCACTGATGGCACTGGG - Intergenic
1113742734 13:112722577-112722599 CTTCCGGCCCTGATGGGACTCGG - Intronic
1113928330 13:113953202-113953224 CCCGCTTCTCTGATGGGAGTTGG + Intergenic
1114479724 14:23025222-23025244 CACCCAGCACTGTTGGGGCTGGG - Intronic
1114806463 14:25842718-25842740 ACCCCTTGACTGTTGGGACTTGG - Intergenic
1115446864 14:33500416-33500438 TCCGCTGCACTGATCGGACTTGG - Intronic
1117006025 14:51421871-51421893 CCCCTTGCTCTGGTGGCACTTGG + Intergenic
1117142298 14:52801504-52801526 CACCCTGCACTGAAGGGAAGTGG + Intergenic
1118937234 14:70299179-70299201 GTCCCTGCACAGATGGGACATGG + Intergenic
1120452971 14:84694523-84694545 ACCACTGCACTGATGGTAATTGG - Intergenic
1120768849 14:88356871-88356893 CCTCCTTCACTGATTGGAATGGG - Intergenic
1121408430 14:93733281-93733303 CCCAGTGCACAGGTGGGACTTGG + Intronic
1121485400 14:94310626-94310648 CTACCTTCACAGATGGGACTTGG + Intronic
1121509290 14:94500496-94500518 CCGCCTGCACTGATTGGATTAGG - Intronic
1122409123 14:101517137-101517159 CCCACTCCACTGCTGGGAGTTGG + Intergenic
1126788192 15:52196252-52196274 CCCACTGCACTGATGTGTCAGGG + Intronic
1127881356 15:63161373-63161395 GCCCCTGCACTGATGGCAGATGG + Intergenic
1128350444 15:66885007-66885029 CCCCCTTGACTGAAGGGACCTGG - Intergenic
1128536815 15:68497835-68497857 CCCCCTGGTATGATGGGATTTGG - Intergenic
1129129874 15:73483997-73484019 GCCCCTTCACTGTAGGGACTGGG + Intronic
1130974013 15:88759011-88759033 CTCCCTGCTCTGCTGGGACATGG - Intergenic
1132841837 16:1981852-1981874 TCCCCTGCAGTGAGGAGACTTGG + Exonic
1132998329 16:2835906-2835928 CCCCCGACAATGGTGGGACTGGG - Intronic
1136544342 16:30947395-30947417 CCCCCTGCACTGATATCTCTGGG + Exonic
1137539196 16:49350356-49350378 GGCCCTGAACCGATGGGACTGGG + Intergenic
1138534411 16:57652439-57652461 CCCCCACCACTGACGGGCCTGGG - Intronic
1139322615 16:66127645-66127667 CCACCTGCACTGATGGGGAAGGG + Intergenic
1139393754 16:66623245-66623267 ACCACAGCACTGAAGGGACTGGG + Intronic
1140302621 16:73773032-73773054 GCCCCTGCACTGATCAGCCTGGG - Intergenic
1140410593 16:74738384-74738406 CCTCCTGCAGTGATGGGGCCGGG + Intronic
1140477610 16:75246824-75246846 CCTCCCGCACTGCTGGGCCTAGG + Intronic
1140571325 16:76109688-76109710 CTCCTTGCAGTGATAGGACTGGG - Intergenic
1141941265 16:87277766-87277788 CAGCCTGCACTAATGGGCCTAGG + Intronic
1144717590 17:17445307-17445329 CCCCCTTCCCTGAGGTGACTGGG + Intergenic
1144735343 17:17552538-17552560 CCCACCGCCCTGATGGGGCTTGG - Intronic
1144887023 17:18470292-18470314 CCCCATGGACTCAGGGGACTGGG - Intergenic
1145145193 17:20474003-20474025 CCCCATGGACTCAGGGGACTGGG + Intergenic
1146353744 17:32117367-32117389 CCCCATGGACTCAGGGGACTGGG - Intergenic
1146628681 17:34454479-34454501 CCACCTCCTCTGATGGGAGTAGG + Intergenic
1148505877 17:48126722-48126744 CTCAGTGCACTGGTGGGACTGGG - Intergenic
1149660813 17:58333125-58333147 CCCGGTGGACTGATGGCACTAGG + Intergenic
1150286020 17:63954599-63954621 TCCCCTGCACCTATGGCACTTGG - Intronic
1152097245 17:78279216-78279238 CTCCCTGCACTGAAGAGGCTGGG - Intergenic
1152646403 17:81470708-81470730 TCCCCTGCTTTGATGGGACAGGG - Intergenic
1152737750 17:82005594-82005616 CCCCCTGCACTGCTGAGGTTTGG + Intronic
1157090129 18:44627225-44627247 CCCTTTGCACTGAGGGGATTTGG + Intergenic
1157287367 18:46386105-46386127 GCCCCTGGACAGATGGGCCTTGG - Intronic
1159749907 18:72287047-72287069 CCCCATGCACAGATGTGACTTGG - Intergenic
1159892690 18:73967434-73967456 CCCCCTTCACTGATGTGCCATGG - Intergenic
1160783852 19:890871-890893 CCCACTGCCTTGAAGGGACTCGG - Intronic
1160872412 19:1283307-1283329 TGCTCTGCACTGCTGGGACTGGG - Intergenic
1161161158 19:2762492-2762514 CCCGCTGCACTCACGGGGCTGGG + Exonic
1162323059 19:9981047-9981069 CCCCCTACCCTGCTGGGACTTGG - Intronic
1163744965 19:19040942-19040964 CCCCATGACCTGCTGGGACTTGG + Intronic
1163900199 19:20093998-20094020 GTCCCTGCACAGATGGGACATGG + Intronic
1167099479 19:47395383-47395405 GTCCCTGCACAGATGGGACATGG - Intergenic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
1167901122 19:52623085-52623107 GTCCCTGCACAGATGGGACGTGG - Intronic
1168270557 19:55247479-55247501 CCCTGTGCACTGAGGGGCCTCGG + Intronic
925191422 2:1887508-1887530 CTCCTTGCACTGAGGGTACTTGG + Exonic
929383559 2:41380270-41380292 GTCCCTGCACAGATGGGACATGG - Intergenic
935585513 2:104796816-104796838 TCCTCTGCAATGATGGGAATCGG - Intergenic
935817895 2:106864293-106864315 CCTCCTGCTCTGATGGCCCTTGG + Intronic
936147001 2:109986849-109986871 CCCCGCGCCCTGATGGGGCTGGG - Intergenic
936197691 2:110384634-110384656 CCCCGCGCCCTGATGGGGCTGGG + Intergenic
936327645 2:111519446-111519468 TTCCCTGCACTCATGGGACCAGG + Intergenic
942304425 2:174591934-174591956 TCCCCTGTACTGTTGGGAGTGGG - Intronic
944511661 2:200471736-200471758 CCCAGTACACTGAAGGGACTGGG + Intronic
946215011 2:218177405-218177427 CATCCTGCACAGATGGGACACGG + Intergenic
947119263 2:226799236-226799258 CCCCGTGCAACGTTGGGACTTGG - Exonic
947702405 2:232245306-232245328 CCCCCTGACATAATGGGACTTGG + Intronic
948327728 2:237139985-237140007 CCCCATGCGCTGCTGGGGCTGGG + Intergenic
948891790 2:240910340-240910362 CCCCCAGCTCTGAGGGGACTGGG - Intergenic
1170029226 20:11927433-11927455 CCTCCTTCATTGTTGGGACTTGG + Intergenic
1172605172 20:36209102-36209124 CCACCTGCACGGATGGGCCTGGG + Intronic
1174087458 20:48019311-48019333 CTCCCTGCTCTGATGGGAGAGGG + Intergenic
1174128827 20:48327659-48327681 CTCCCTGCTCTGATGGGAGAGGG - Intergenic
1174442466 20:50566989-50567011 CTCCCTGTGCTGAAGGGACTCGG - Intronic
1175999516 20:62825691-62825713 CCCCCTTCACAGCTGGGCCTTGG - Intronic
1178535184 21:33404380-33404402 GCCCCAACACTGATGGGACCCGG - Intronic
1179710752 21:43211768-43211790 CCCACAGCACTTAGGGGACTTGG - Intergenic
1180160596 21:45997284-45997306 CCCCCTGCACTGATGGGACTGGG + Intronic
1180945300 22:19689186-19689208 CCCCCTGCACTGGGGGGACGAGG - Intergenic
1183940330 22:41290979-41291001 TCCCCTCCACTGGTGGGAGTGGG + Intergenic
1184215367 22:43063355-43063377 GGTCCGGCACTGATGGGACTGGG - Intronic
1184538300 22:45102522-45102544 GTCCCTGTCCTGATGGGACTTGG - Intergenic
1184844416 22:47072458-47072480 GCCACTCCACGGATGGGACTGGG - Intronic
949463612 3:4320843-4320865 CTCCCTGCACTTATGGGAGTAGG + Intronic
952321393 3:32281067-32281089 CCCCATGCAGAGATGGGGCTTGG - Intronic
954161746 3:48727702-48727724 GTCCCTGCACAGATGGGACACGG + Intronic
954337828 3:49929948-49929970 CCCACGGCTCTGCTGGGACTAGG - Exonic
954678350 3:52327701-52327723 CCCTCTCCACTGCTAGGACTGGG - Intronic
961102686 3:124215034-124215056 CCCCCTGCCCTTATGAGACTGGG - Intronic
961504711 3:127362485-127362507 CCCCCAGCACTGCTGGGAGCTGG - Intergenic
978329164 4:107593458-107593480 AGCCCAGCACAGATGGGACTTGG - Intronic
982180462 4:152744710-152744732 GTCCCTGCACAGATGGGACATGG + Intronic
988510429 5:31860063-31860085 TCCCCTACACTGAGGGGAGTTGG + Intronic
991459074 5:66837714-66837736 CCCACTGCTCTTAGGGGACTAGG + Intronic
991622027 5:68555132-68555154 CCGACTGCACCGCTGGGACTTGG - Intergenic
992552670 5:77874118-77874140 CCCACTGCACTGATGGAAATGGG - Intergenic
995516601 5:112960433-112960455 GCCCCTGCACAGATGGATCTAGG - Intergenic
996746552 5:126851228-126851250 CTCCCTGCTCTGATGGGATTTGG + Intergenic
997770609 5:136549698-136549720 GTCCCTGCACAGATGGGACATGG + Intergenic
998167547 5:139852822-139852844 CCCCCTGCAAGGATGGGCCAGGG - Intronic
998926837 5:147135852-147135874 CCCCATCCCCTGATGGGACACGG + Intergenic
999381293 5:151123322-151123344 CCCCTTCCCTTGATGGGACTTGG + Intronic
1005857504 6:29873670-29873692 CCTTCTGCCCTGATGGGTCTGGG - Intergenic
1005863299 6:29917776-29917798 CCTTCTGCCCTGATGGGTCTGGG - Intergenic
1006069406 6:31487365-31487387 TCCCCTGCAGAGAGGGGACTTGG + Intergenic
1007300965 6:40867584-40867606 GTCCCTGCACAGATGGGACATGG + Intergenic
1016662482 6:146597834-146597856 TCCCCTCCACTCATGGGACTGGG - Intergenic
1018833912 6:167469265-167469287 CCTGCTGCACTGATGGGCTTCGG - Intergenic
1019377279 7:699545-699567 CTCCCTGCAGAGCTGGGACTTGG + Intronic
1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG + Intronic
1021801023 7:24306481-24306503 ACCTCTGCACTGAGGAGACTTGG - Intergenic
1021910864 7:25385003-25385025 TCCCCTGCAGGGCTGGGACTGGG + Intergenic
1026155146 7:67819750-67819772 CCCCCTGAGCTGAAGGGATTAGG - Intergenic
1027926775 7:84475097-84475119 GCCCCTGCACTCCTGGGACCCGG - Intronic
1028975980 7:96914627-96914649 CCACCTGTGCTGATGGGAATTGG - Intergenic
1030059718 7:105612942-105612964 CACACTGCCCTGATGGGTCTAGG + Intronic
1033909450 7:146246757-146246779 TGTCCTGCACAGATGGGACTCGG + Intronic
1037769279 8:21789362-21789384 CCCCCTGCGCCGCTGGGTCTGGG + Intronic
1037780426 8:21864743-21864765 CCCACTGCTCTGAAGGGATTTGG - Intergenic
1039484633 8:37900826-37900848 CCCTCTGCAGAGCTGGGACTGGG + Intergenic
1040934329 8:52767044-52767066 CGCCCTGCCCCGATGGGACCAGG - Intergenic
1041990101 8:63977190-63977212 CACACTGCAATGGTGGGACTGGG + Intergenic
1043914657 8:85907384-85907406 CCCCCTGCTCTGCAGGGCCTTGG - Intergenic
1047108240 8:121759018-121759040 CCCCCTGCACTTTTGGGAACTGG + Intergenic
1050346227 9:4690935-4690957 CACTCTCCACTGATGGAACTTGG - Intronic
1051842664 9:21415976-21415998 CATCCTGTACTGATGGCACTAGG + Intronic
1052743039 9:32412586-32412608 TCCCCTGAATTGATGGTACTTGG + Intronic
1055715122 9:79109013-79109035 CCTCTTGCACTGATGTGACCAGG + Intergenic
1057299689 9:93870677-93870699 CCCCCTGCTCTGTTGGGGCTTGG + Intergenic
1057416793 9:94870927-94870949 CTCTCTGCCCTGATTGGACTAGG + Intronic
1058198446 9:102008487-102008509 CCCCCTCACCTAATGGGACTTGG + Intergenic
1060226216 9:121792657-121792679 GTCCCTGCACAGATGGGACATGG - Intergenic
1061791399 9:133061063-133061085 CCCTCTGCAGTGATGGGAACAGG - Intergenic
1061795077 9:133081630-133081652 CCCTCTGCAGTGATGGGAACAGG - Intronic
1186740356 X:12510864-12510886 CTCAGAGCACTGATGGGACTTGG + Intronic
1187317219 X:18207064-18207086 CCCCCTGCACTGCTAGGCCAGGG - Intronic
1188301039 X:28505802-28505824 GTCCCTGCACAGATGGGACATGG + Intergenic
1189286278 X:39854474-39854496 ACCCCTGTATGGATGGGACTGGG - Intergenic
1189301017 X:39952387-39952409 CCTCCTGAACAGCTGGGACTAGG + Intergenic
1190022269 X:46890113-46890135 CTTCCTCCACTGATGGGACGAGG + Intronic
1192215003 X:69151938-69151960 CCCCCTGGACTCCTGGAACTTGG - Intergenic
1193579979 X:83252374-83252396 ACACCTGCTCTGATGGGAGTGGG - Intergenic
1193924680 X:87469015-87469037 CCCCCTGCACAGATGGGAAATGG - Intergenic
1196469923 X:116013007-116013029 GTCCCTGCACAGATGGGACATGG - Intergenic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic