ID: 1180162713

View in Genome Browser
Species Human (GRCh38)
Location 21:46005514-46005536
Sequence CAGAGCAAGAAGAGGGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180162700_1180162713 22 Left 1180162700 21:46005469-46005491 CCTTTGGGGCAGAGGAAGAAGTC No data
Right 1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG No data
1180162699_1180162713 25 Left 1180162699 21:46005466-46005488 CCACCTTTGGGGCAGAGGAAGAA No data
Right 1180162713 21:46005514-46005536 CAGAGCAAGAAGAGGGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180162713 Original CRISPR CAGAGCAAGAAGAGGGCGGA GGG Intergenic
No off target data available for this crispr