ID: 1180166118

View in Genome Browser
Species Human (GRCh38)
Location 21:46030622-46030644
Sequence CAAATTGGTCCCCAGTGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180166113_1180166118 21 Left 1180166113 21:46030578-46030600 CCTCTGCTGTGGTCTGAATGTGT No data
Right 1180166118 21:46030622-46030644 CAAATTGGTCCCCAGTGCGGTGG No data
1180166115_1180166118 -3 Left 1180166115 21:46030602-46030624 CCACAAAATTCATGTGTTGGCAA No data
Right 1180166118 21:46030622-46030644 CAAATTGGTCCCCAGTGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180166118 Original CRISPR CAAATTGGTCCCCAGTGCGG TGG Intergenic
No off target data available for this crispr