ID: 1180169178

View in Genome Browser
Species Human (GRCh38)
Location 21:46049076-46049098
Sequence TAGAGGGCATGGAGGGCGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180169178_1180169196 29 Left 1180169178 21:46049076-46049098 CCCACCGCCCTCCATGCCCTCTA No data
Right 1180169196 21:46049128-46049150 TCCCAGTTGGCCCAGCTCAAGGG No data
1180169178_1180169195 28 Left 1180169178 21:46049076-46049098 CCCACCGCCCTCCATGCCCTCTA No data
Right 1180169195 21:46049127-46049149 CTCCCAGTTGGCCCAGCTCAAGG No data
1180169178_1180169191 16 Left 1180169178 21:46049076-46049098 CCCACCGCCCTCCATGCCCTCTA No data
Right 1180169191 21:46049115-46049137 CCCGTCCACCTTCTCCCAGTTGG No data
1180169178_1180169198 30 Left 1180169178 21:46049076-46049098 CCCACCGCCCTCCATGCCCTCTA No data
Right 1180169198 21:46049129-46049151 CCCAGTTGGCCCAGCTCAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180169178 Original CRISPR TAGAGGGCATGGAGGGCGGT GGG (reversed) Intergenic
No off target data available for this crispr