ID: 1180169374

View in Genome Browser
Species Human (GRCh38)
Location 21:46050014-46050036
Sequence GTGTTGACCTCCAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180169374_1180169381 5 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169381 21:46050042-46050064 TGTCCGCTGGGCGTCTGACCTGG No data
1180169374_1180169386 22 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169386 21:46050059-46050081 ACCTGGAGGACAGGGCTCCAAGG No data
1180169374_1180169385 14 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169385 21:46050051-46050073 GGCGTCTGACCTGGAGGACAGGG No data
1180169374_1180169384 13 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169384 21:46050050-46050072 GGGCGTCTGACCTGGAGGACAGG No data
1180169374_1180169379 -7 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169379 21:46050030-46050052 TCAACACTCCAATGTCCGCTGGG No data
1180169374_1180169383 8 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169383 21:46050045-46050067 CCGCTGGGCGTCTGACCTGGAGG No data
1180169374_1180169378 -8 Left 1180169374 21:46050014-46050036 CCCTCATCCCTGGAGGTCAACAC No data
Right 1180169378 21:46050029-46050051 GTCAACACTCCAATGTCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180169374 Original CRISPR GTGTTGACCTCCAGGGATGA GGG (reversed) Intergenic
No off target data available for this crispr