ID: 1180170895

View in Genome Browser
Species Human (GRCh38)
Location 21:46057624-46057646
Sequence CCCACCACGCAGGTGCCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180170886_1180170895 15 Left 1180170886 21:46057586-46057608 CCCACACGACAATCTCTAGGGGG No data
Right 1180170895 21:46057624-46057646 CCCACCACGCAGGTGCCCAGTGG No data
1180170888_1180170895 14 Left 1180170888 21:46057587-46057609 CCACACGACAATCTCTAGGGGGC No data
Right 1180170895 21:46057624-46057646 CCCACCACGCAGGTGCCCAGTGG No data
1180170881_1180170895 29 Left 1180170881 21:46057572-46057594 CCTCAGTTCCGTCGCCCACACGA No data
Right 1180170895 21:46057624-46057646 CCCACCACGCAGGTGCCCAGTGG No data
1180170882_1180170895 21 Left 1180170882 21:46057580-46057602 CCGTCGCCCACACGACAATCTCT No data
Right 1180170895 21:46057624-46057646 CCCACCACGCAGGTGCCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180170895 Original CRISPR CCCACCACGCAGGTGCCCAG TGG Intergenic