ID: 1180172447

View in Genome Browser
Species Human (GRCh38)
Location 21:46066867-46066889
Sequence GTTTCTAAAGGGCTCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180172447_1180172455 22 Left 1180172447 21:46066867-46066889 CCATCCAGGAGCCCTTTAGAAAC No data
Right 1180172455 21:46066912-46066934 ACCCTCTTTAAAAATGCGTGCGG No data
1180172447_1180172460 28 Left 1180172447 21:46066867-46066889 CCATCCAGGAGCCCTTTAGAAAC No data
Right 1180172460 21:46066918-46066940 TTTAAAAATGCGTGCGGGCTGGG No data
1180172447_1180172459 27 Left 1180172447 21:46066867-46066889 CCATCCAGGAGCCCTTTAGAAAC No data
Right 1180172459 21:46066917-46066939 CTTTAAAAATGCGTGCGGGCTGG No data
1180172447_1180172457 23 Left 1180172447 21:46066867-46066889 CCATCCAGGAGCCCTTTAGAAAC No data
Right 1180172457 21:46066913-46066935 CCCTCTTTAAAAATGCGTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180172447 Original CRISPR GTTTCTAAAGGGCTCCTGGA TGG (reversed) Intergenic
No off target data available for this crispr