ID: 1180175316

View in Genome Browser
Species Human (GRCh38)
Location 21:46084355-46084377
Sequence GGTCTGCTGCCGCTGCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175316_1180175325 22 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175325 21:46084400-46084422 TGAACCCTCCTGCCGTCCTGGGG No data
1180175316_1180175323 20 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175323 21:46084398-46084420 TCTGAACCCTCCTGCCGTCCTGG No data
1180175316_1180175331 30 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175331 21:46084408-46084430 CCTGCCGTCCTGGGGGCTGCGGG No data
1180175316_1180175329 29 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175329 21:46084407-46084429 TCCTGCCGTCCTGGGGGCTGCGG No data
1180175316_1180175326 23 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175326 21:46084401-46084423 GAACCCTCCTGCCGTCCTGGGGG No data
1180175316_1180175324 21 Left 1180175316 21:46084355-46084377 CCTGTGAGCAGCGGCAGCAGACC No data
Right 1180175324 21:46084399-46084421 CTGAACCCTCCTGCCGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175316 Original CRISPR GGTCTGCTGCCGCTGCTCAC AGG (reversed) Intergenic
No off target data available for this crispr