ID: 1180175319

View in Genome Browser
Species Human (GRCh38)
Location 21:46084386-46084408
Sequence GAGGGTTCAGACGGGAACAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175319_1180175332 2 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175319_1180175334 3 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175334 21:46084412-46084434 CCGTCCTGGGGGCTGCGGGAGGG No data
1180175319_1180175325 -9 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175325 21:46084400-46084422 TGAACCCTCCTGCCGTCCTGGGG No data
1180175319_1180175326 -8 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175326 21:46084401-46084423 GAACCCTCCTGCCGTCCTGGGGG No data
1180175319_1180175331 -1 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175331 21:46084408-46084430 CCTGCCGTCCTGGGGGCTGCGGG No data
1180175319_1180175335 4 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175335 21:46084413-46084435 CGTCCTGGGGGCTGCGGGAGGGG No data
1180175319_1180175338 22 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175319_1180175329 -2 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175329 21:46084407-46084429 TCCTGCCGTCCTGGGGGCTGCGG No data
1180175319_1180175324 -10 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175324 21:46084399-46084421 CTGAACCCTCCTGCCGTCCTGGG No data
1180175319_1180175337 21 Left 1180175319 21:46084386-46084408 CCCGTGTTCCCGTCTGAACCCTC No data
Right 1180175337 21:46084430-46084452 GAGGGGCTACCAGCCAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175319 Original CRISPR GAGGGTTCAGACGGGAACAC GGG (reversed) Intergenic
No off target data available for this crispr