ID: 1180175321

View in Genome Browser
Species Human (GRCh38)
Location 21:46084394-46084416
Sequence GACGGCAGGAGGGTTCAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180175321_1180175331 -9 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175331 21:46084408-46084430 CCTGCCGTCCTGGGGGCTGCGGG No data
1180175321_1180175340 23 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175340 21:46084440-46084462 CAGCCAGACGAGGGCTGACCCGG No data
1180175321_1180175338 14 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175338 21:46084431-46084453 AGGGGCTACCAGCCAGACGAGGG No data
1180175321_1180175332 -6 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175332 21:46084411-46084433 GCCGTCCTGGGGGCTGCGGGAGG No data
1180175321_1180175343 27 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175343 21:46084444-46084466 CAGACGAGGGCTGACCCGGGAGG No data
1180175321_1180175337 13 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175337 21:46084430-46084452 GAGGGGCTACCAGCCAGACGAGG No data
1180175321_1180175335 -4 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175335 21:46084413-46084435 CGTCCTGGGGGCTGCGGGAGGGG No data
1180175321_1180175329 -10 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175329 21:46084407-46084429 TCCTGCCGTCCTGGGGGCTGCGG No data
1180175321_1180175334 -5 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175334 21:46084412-46084434 CCGTCCTGGGGGCTGCGGGAGGG No data
1180175321_1180175341 24 Left 1180175321 21:46084394-46084416 CCCGTCTGAACCCTCCTGCCGTC No data
Right 1180175341 21:46084441-46084463 AGCCAGACGAGGGCTGACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180175321 Original CRISPR GACGGCAGGAGGGTTCAGAC GGG (reversed) Intergenic
No off target data available for this crispr